Description :
From Genome Similarity Track
Location :
Scaffold_5:904- 3444
Sequence
2540 bases(100 bases per row)
ACTTTATGTATTTTACATTGACTCTAATACCTGATCTCATCGGAAAAAAAGGGTATTAGTTGTTACCCGTCTCGTTCTCACGCTCTAGTCTGTATTTATC
ACTGTGAAAACAATGTTGAGGAGCTCTAGAAGCAGTTTAGGACATCTAGCAGTACCAGTCTATTTGTTATTGCCAAAGGAATCTGCTAAGCAATTCACCT
GCGATGTCAACATTGGCACTTGCAACTCAATATCGAGATATTACAAGTATACGATCTGCTCTGTCGTGCTTCGTATCCGGATGTGTTTCGATTCGAAATT
TAATATCAGTATAGTTGTATGATCAAGGTCAACAATGCCCACGTATCCGGATGCAAGAAGTGCGCCTTTTGCCCCCCCCTCCACCGTCACTCGTCGAGAT
GGCACAGAAGCGCCGAGTAGGCAGCGGGCGCGACGCCCAGCCGCCCCGGAAGGCGCGAGGAAAAGCAGCGAGGACAGTGAACTCCGAGGCATCTGGTAAG
CAAAACGTATCTTTCACTAGCAAAGCGTCGTAGCGATATTATAGTAGACGTTCATAATGCCGCAGACGACGAGTTTGAAGTCGAGAAGATCATCGAGATG
AAGTTCGTGCGTGGAGCCCAAGTACCATGTGAAGTGGAAGGGTTACGACGAGACGTCGTGGGTGCCGGAATCGAATCTGCATTGTCCTGAGCTCCTCAAC
AAGTTTAAGGTAGCACAACTTCAAGAGGCACGCGCGTTGAAGAAAAAAGCAACCCGAAAAGCGGACTTGCCTGACCGAGGTAGCCACGTGACAGCTAAAA
TCCCTGCAAAACACCAAGAGGGTTCTGAAGGTAACAAGCAGCACGTGTTTGTCACATGCTCTTATGTTGGTTTTGGGAAAATGTACTAACTGTAATAATG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAGATGAGTTTGCAGATGAG
CTTTATATTGCGGGTGATACCGGAAACGAAAGTTTTAGTGTCGAAACAGCAGAGGAAATTCGCGCGGTTGCCGGCCCCCAGGACTACATAACAGATGAAA
TGCTTCGAGGCATGTCTGACAATGGTTGGGAGTTGCTACCGGTAACCGACGAACGGGATGACTCGGACCTGTCCGGCGCTACGGATGTGTTTACGGACCC
TCCTCAACTTACTGCCTCGGCTATAGAGGCAGCGAAAACG