Description :
From Genome Similarity Track
Location :
Scaffold_1575:904- 2862
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1575-snap-gene-0.0Reverse transcriptase

Sequence
1958 bases(100 bases per row)
GCTTGGAgCTGCCGTGACTGGTAGGAGACGACTCTCTCGTGACCCTCACTGTCCTTCTGCAGCAATGCACAACCGATAGCATAGTCGGATGCGTCATACA
CAACGCTGTACGGCTTGGAGTCGTCAGGCAGAGCCAATACCGGAGCCTGAAGGAGGCTCTCCTTGATACGCTGAAATGCAGCTTCGGTCTCTGGTGACCA
GGACCACTCAACATCGTTCTTGAGAAGCTGGGTCAGCGACCGAGCCATCTCAGCGTAGTTCTTCGTGAACCGATGCAGATAGTTGGCATGACCCAACCAC
TTGCGCAAGTCCTTCACCGACTTTGGCGATGACCACTCGGCGATCGCCTTGACCTTCTCAGGGTCAGGATGAACTCCTTCAACCCCGACGAAACACCCTA
GCACGGGGATTTCGTCTGCACCAAAGATGCACTTGTCCAAGTTGGCGTAGAGCTTGTGCTCTTCGAGACACTCTAAAACTTGACGAAGGTGgTCCTCATG
GAGCGAATCCAAGTCACGACCAGGCTCTGGCTTCGTGTGGACGTAAATATTGTCAAAGTACGTCTGTGCGAAGGCTCGCAAAGGCCGGAAAAGGTGTGTC
ACCAAGCGATTGAACGTCGTGGGAGCATTGGACAACCCTTGTGGCATCACGAGCCACTCCCACAGCATGCCACTGGGGGTGCTGACCGCAGTCCTGGGGA
TATCCAACTGCTCCATGAGCACTTGGTAATAACCATCGACCAAGTCATGGGAGCTCAaTCGCTTCGCACCGGACATTCGGTGGATGATGACATCCTTCCG
AGGAATCGGACTCGACGCTGGGACCGTCTGAGCATTCAGCTTGTTGTATGCGTGGGCGATCCTCCATTTGCCATTTGGCTTCCGCACACAGAACGTGGGT
GCGCTGTGAGGAGAAACACTCTCACGCACAAGTCCGGCCTTGTGCTTCTTGGCGAAGAACTCGTTGATGAAGTCGGACTGTTCCGCTGGAAGCGCCCACT
GACGCACCGTCGCATAGGTCGACCCTGGCTTGAGCTTGATCTCATGTCGAATGCCTTGGCCAAGCACGTCTTGGAGAATCGCTTCACTAGCGGGTAGTAC
CGATCCTTCGGATTCTTGAGAATGGCCGAACCTCGGCGAGCGTCAAACTTCTGACGAAACTCAACTAGGACGGATTCGTCGATCACAGACGATGTGTTGA
GTTCGGCGAGGTCTCGCTCGGAACGAAGAATGACTACTTCCGCTAGCTCACCAGCCTTCAGCTGTTCGACAAACGTGTCCATGGACATCTCTTCCAATGT
GACTAACTCGTCCACAGTAGGCAACGGTGCCATATCGACTGTTGATGGGTCAATCGACCCGCCGGTGACGGCATCAATGACGCTCAGCGTATCCGTCGCA
GGACCAAGAACAGTTGATACTGGAGTTCGAAACTGAACACGACGACGACGCCNNNNNNNNNNNNNNNNNNNNCATTCACGTCGATGGCACTGAGATCCAT
CAGACTCAGATCGACCCcTGATAGGTCGAGAAGTGGTTCGACCACACTCAAGTCCATCGGCTCCGGCACCGGTGGCGCTGGTGTCAACACATGTGTCGGT
GCCACTGGATTGGCGGGAAGGCCGCGAGCGAGTTTTTGGATATAATCCTCTCGCAACGCAACCATGAAGGCTTCTTCGAGAGTTGCCGGCTCCTCGCGGA
ACACTGCAGCATCGGCGGGACCAACCTTCATGCTGTCAATGAAGACAGTCAACATGACATCTTCGGCTAGTGCGTTCGCAGCCATGCTAGAACGGAGTTG
ACGTAACTCTTGAACGTAAACATAAGTTCACGTTCACCTTGAGTGCATGCAAGGAATGCCGCACGTTGACGGTGAGCCACATTTGGCGGTTGGAAAACaG
AGCGCATCTGTTCGACCAGAGTTGCCCAGCTGGAAAAATaTCCAGGCTGAGAGGTCTC