Description :
From Genome Similarity Track
Location :
Scaffold_7:903917- 911098
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05305hypothetical protein
Phypa_INRA-310PPTG_05306protein kinase
Phypa_INRA-310PPTG_05307condensin-2 complex subunit G2
Phypa_INRA-310PPTG_05308T-complex protein 1 subunit alpha

Sequence
7181 bases(100 bases per row)
GAGGAACGCAGAAAGCAGGAGGAAGCGCGCGAGCTGCGTGCTCGACAGCGGAATGCGGACGAGGAATGGCAGCAAGTAGAGCAGGAGACAGCGGAAGCTG
CAGCTGAGCAGGTTACAGCGTCTGCGAAGCCTTAGCGGCCTCAACATACCTTCAGAAGAAAAATGCACATTCCTCAGTAAAAAAAAATAGAGATCATTGC
AAGTGACACTACTGTACGTTGAGATAATCATCCTGTGCAGGGCGCGTTCAAGGTGAGGTGGCTTCGAATCTTGATGTAGAGGATGAAACGCAACAACGTG
TTGTCTACAAGCATTCGCCGTGTTCTTGTTGCACGAAAAGCACGAAGTAATTCAGCTATGCCATTTCCAAGATTTGCATGCCATCGTGAAAAACATGAAG
AGCATGGACCGACAGGCCGATGTTGCGCTCGTAATACGAGGCGTATAATACCTCGCAATACACATCCATGCTTGCTTCACTTGCTTGGGTTTGCTTCGTT
TTTTGCTTCTGGGACGCTGCCACGGATACATTGTTGACGGATGCAGTGTGTGTAGCGCGGAAACCAATTGCGTAGTCATGAAGCCAAGCAGCCCGCCGAC
CAGTCTCAGCATGCGAAGCAAAGCTGGTCGGTCGGCTGAGCACAAGTACCGACCGGATCGATTGCTAGAGCTCAAGTTGGCGATTTTGTACCCATCCATT
GGATACTTGCAGCGTTGCGTCGTACGGTCCAACTTGGACTCCAGGCTAGGCGGCATTACTACATCGCTTGACAGCGGAGATGGCTGTTATTTGAAGAGAG
ACTGCGCTCAATTGTCCTCCGAACTGCACACTGCTCAAGGAATCCGCTAAACCAGCCCCATATCATTTCAAACGCCGGTTGGTCGACGCGAACGAGCAAC
GCGAGTCTCGCAACCAGCGCAAAGGTTGTGACTAATGACATGCAAACTACAGGGTGGACTGGAACCTCGACGCTCATGGAACTTCAGAAAATGCACGGGC
CGAGTTGTACTCGATATGAGGCTCATAGTGAGGCATACGGAGCAAGTTGCACTTGAAGGCAAATTTGCAGCAAGTGGCCTGCCACTGTCAGGCCTTTCAT
TCCGACAACCCCTTGAACCCACACTAACCCATTGCCATCTCCACAAACTCGTCGAATGAAAGTTTTACATCCCCATCCAAGCGAAAGAGAGAGATAGCCT
CCTAAAGCCCTTTACCAAGAGCTTGTTATCTTCGAATTGAGTGGCAGAAGGCAACGCCCGCCTTCAGAGATTCCTGCGACAACCTGTTTCCAGGAAAACC
TTAGCAGATGGTGCACCGTCCATAGAAAACTCAAATGTGCCCCTTGAAGTACCTTTGCATACTGAACCCAAGTATCCGCAAAAGTGTAGCTGCCCATGTC
CTCATCCGCTAATTTCTCACTCTGCAAAACGCTTGGAAGCCAACGCATCCAGTGACAGCTAGGGACCCACATGGTCATGCAGCAGTACGAGCCGCTGGAG
ACGCTGGCACCCGCGCTCTTCGGCAATGTTCAAAAGTGGCGCCATACGCCTTCGGGCGAGTACGTGGCGGTCAAGCGCATGGAGCTGCGCTTTGCAGCGC
GCAAGCGCTCCAAGAGCTCCGAGCGCGCTGTGGAGGAGGATCTATTCACAGAGATCAAAACGAACTTGCGCGTGCAGTCGCTGGGTGGCCACCCTAACGT
GTTGCCATTGCGCGATTGCATCATGGAGGACGAGGCCGTGCTGCTCGTGCTCAAATTCTGCGAACGCGGCGAGCTACTCGACGTAGTCAACACACAACGA
GCAGCCGGACAGCAGGCCAATGTGACGCGCTACTTTGCGCAGATCTTACGCGGCGCAGCGTTCCTGCACGCTAATGACATTGCACACCGCGATCTGTCTT
TGGAGAACGTATTAGTGGACGAGCGCGACTGCTGCCAGATCACGGACTTCGGTCTAGCTGCGCAGTGCAAGGGAAAAGTGAATGTGAGACCTGTGGGCAA
ACTTAGGTACATGGCCCCGGAAGTTAGTGCAGCAATGGTGTATGAAGAAGGTCATCAGAACGAATATGACCCCAAGGCAGCGGACGTATGGGCACTCGGA
GTGATGCTGTATGCCATGGTGACGGCTCGGTATCCGTTCCGTGAACCTCTGCGTAAAGATGACCGGTTCAGATTGTTGGAGGATTTTGGAGTGGAGTATT
TGTTGGAGAAGGATGAGGTGGATATGGCGGGGGAGGAAGAAATGGTGGATCTATTGAAGAAACTATTAGTCGTCGACCCCGCCGAGCGCTCAACGCTCGC
ACAGCTGGAGTCGCATCCAGCGCTGCCTGCCGTGGAAGGCAGCGAGACTCGACCTGCGAGTCCTACTATGATTGGAGAGGAGCAACCGGAGGATTCATTG
GCGCAGTTGAGTGTCTCGAACAATGACGACACACGGCAACGCGCGCGGTCGCTTGGTCGCTTTAACGGGAAGGGATCGCTCGCATCGGTGAGCCCCAACA
CACCACTATCAGAGGCGGGGAAGAACAAGCAAGCGCTTGCTTCTTCGGCCATCAAAGCAACAGCTGTGTCTTCAGCTCCTGTGACCGGTAATAATGGGTC
AAAGAACCAATGTGCCGGTGGCAGGTTGCTGCGCAAGTGCTTCGCCACGCGCGCGTAATGCTAGCAAGCACACGCTGTACATTATCTATTAGACGAGAGG
CGGGTAGCCTCCGTTCAGCTATATTATCAATCAACCGAAACGATCCTTATCAACCCACATTTGAGTCACTGCGTGTTCAATGCAGCTTCCGTTTGTACAT
TATGAGCAGGTGTCCTTACGCTGCTGCCTCCTCAGCGACAGGTGACTCCACTGTACACTGCTCGTGGAAAGAAGCACTGGCTGCTGGCCACAGGTCATCA
CACTTGTCCTTATTCTTTTCATGCGCGCTTTCCAATGCTTGCTGCAATGTGTTTATCCAGTGCTCAAGAGAAGGCACTAGACTTGCAGCCTGAGCTCTTG
TAGCTTTTGTAGCCTTGACGCGAACGCTCTCAAGCAAATGAACAAGCTGGCCAGTCTGGTAGAACACAGTGCGCTCAAAAAACTCCATATCCCGCAATGT
ATCACACAACGTGTCCACGTACGCATCGATAAAGTCTGCAGCAGGGCCGTTCTGCAACCAATGTGTACGCTCAAGAGCAAATGCTACACTTTCCGCCGAC
ATGAGGGACACGAGTGAGAAGAGGTTGCGCCACCGCCTCAGCAGCTCCTTTTGAGGTGAAAGCTGGTCCTCATCCGCGTGATTACCTCGACGTCGCTTCT
TTCCGTGCGTCGTCTGCTCTGTCGCCTCCGTCTCCTTGCGGAAGTCTAGCATTAGTCGAGCAAGCCAAGCAAAAAGCGAGTTGAGCGACTTCGGCGGCGT
GAAGAATTCCGATGGCTGCAAGTCACGTAAGTCGTCCTTCTTCTTCAAGCGCTTCGCTGCCTTCTCTACCAGCAAGGATGTTTCATCGTTCACGTGAGCA
CATTCAGCCATCACTACGACTTTTGCGTACACCTCCAACATGCGAATAAATCCAAACGAGTTCGCCTTGTACGCTTGTTCAGCTTCATCAGCGTCAAACT
CGAGAAGCGGCTCGATGCATCGATTCAGAGCCTCAACGATAGGGTGGAGCAAGGTGTTGAGATTCTTGACATTCTGTAGCTGAGCGATGTACTCAACAGT
ACCAAGTACCACGACGGGGTTCAGCTCTGCCTTCTTGCCCTTCTTTGATTTCGAGCCCGCCGTATCGGAGCGGAACTTGTTTTTTCTCCATTGGTCGAGA
AACTTTTCCAGCTTAGACGTCAAGAACGCGAGCTGGTCCCATTGCACCATGCAATCGACCATCGACTCCAAGAGCTTCCTGTTAAAGTTTTCATTCATCT
TCATCAGGTTTTCCACCAGCCGCTCCAGCAAGACGCCCTCCGACAAATCACCCAGGTAGCCGATGATTTTCCAAATGGAGCTGAGGGCTTCTTGATCATA
CGGACGACCTTCATTATAAGCAAGAAGGAGCGCTTCAAGCGACTCGACGTTTAGCTGCTCTCGCAAAAAGCTCTTGCACTCGGAGTAGCGAGCGTCGCCC
AGCACTTTGACGTGCACGCTCTTAAGAAGATTTCCGATTACTTCTAGCACGACAACTTGGCCGATCACACTGAAGCCTTCCTCTTCATCGTCGTCTTCAT
CTTCCTCCTCATCATCATCTTCCGATTCTTGGGGCTGTTTCAACCGCCGAGATACAAAGTTCAGAGAGCAGCGAAGCAAGAGGGCAGCCAATTTGCACAC
AGAGCCGACCGACACGTGCTCAACCACGTTTGCGTAAAACACCATGGCAGCTTCTGGATTCTTCCTCACTAGAGCGAGACATCGAGCCACTTGCGAAGAT
CCGCCGACACTCTGCGGAAAATACGAGTTCAAGAACAGCGATACGAGCTGCTTGCATGCCAGAGCGCAGTCACGATCCATGACCATCCGGCAAAGCAAGT
CGTTCACTGGTACAACATCATAAAAGTGCAAGTTCCGGATGCTCTTGATTCGGACCAATAGAGCACCGAACTCAGCACGTACTTTCTCATTTCGATCATT
GATCAGAGGAGCGAGCTGTAACATGACGCAGTGATGAATTAGTTAGGACTGATTATTCCACGTCCAAATCATAGCAGCTTACCATAGGAAGGAGTGGCTT
CAGAATCGAGTGCGAGTTGTGGTTGTCCAAGATAAACTGGATGCCTTCAAACACTGCTGCGCGAACACTACTGGAGGACACGTCATTCACCAAATCTACC
ACAAGCTTCGAGATGAAACACCGGATCGTCTCAGCCGGAAGCAGCTCCCAATACACAGAAAGCACCTTGGACACACCTTCAATCGCTGCTACTCGTAACG
CAGGGTGAGAATCACCAAGAAGCTCCTCGAACGTGTCAAACTGCTTCTGGAGAGTCAGATCCATCATTTCGTTGCTAAACGCTGGATCACGGAGCGGAAA
ATTATCGAAGAGCAGAATAGTCGCCTGACGTCGGACGGAATCGTTGGGAGCTTTTACACCACGCCACAGGATGGGGCTACAGATGCGGTATAGCATTTCG
TCCACGCCCGGGTGTCGCTTGTTCTCGAAAAATATTTGAAGCACGGTTCGGACCGCATTGAAGAGAGAAGTACTACCCGAATGAACCGCATCACGGACGT
ATCGCTGAATGCATTCCTCTTCGATTTTCTCTCTGAAGGTGCCCTTACTGCCAACCCAAGCCTGTATATATCACCATAGCGAGAGTTAGTAACCTCAGCA
ATACGAATGAGCCTCAAACATTCCTACTTTGAAGTAGATGCTGCCGTATTTGACAAGGATCGAGTTTCGCTGGTTCGGGATCTGGTTTCTAATGGTCTCG
TTAATATCCTCCACAAACGGAACGTGCAATGTGAATAAGAAGCTCAGGAATGGCACAGCGTCGGGTGATCTAAAGAATGTCGGCTGGATATAGCAGCGCA
GCAAGATATCTCTCAACAGACCACTGCTGTCGTCGTCGAAATCCAGTAGCGGCAGTGCGTCCTTAATCGCAAACAGCCTACGAATCGGATGCTTCTTCGA
GTTGAGATTGCCCGTCGGTGGGGACTCGTAACTACGCACAATTAAGTATGGCAACAGCTGCGTCACCAACGAATGAGCACGACCGCAGAAGTTGTGCTTC
CAACATGCCTCACAGAGCAGTGAGATGGCTTCCTGGGTGGCCAGCACTTGGTCTGCGTCTCCTTTCAGTCTCAGCAGCTGGTCGTGAAGCTCTTGAGCTA
CAGCGAAGAGCTCTTCCTTGTCGATGGCCGCACCTTTGGTCTCAACGAGCAGCGCCGTGAACTCGGCGATGCACTCGCGGGCTTGTAGGCGTCTAGCCTC
CTCCTCTTCGTTGTCACTCGGGGCAACAAGCTGCACGGCCGCAGGGTAGAAAGCGTCCAGCTGTTCACGAGGCAGCGCGCGCACCTCGTCGCCCAACTGC
GACTTGTCCTGTATGGAATCCGCGTCGGTTTCGGCGTCCTCCTCCTCAGCCTCACCGTCGTCAGCGCTCTTTTTCTTCGTCTTGCGCTTCCCCTTTCCAG
GCTTGCGGCGTTGAACCCTACGCTGCGCCATTATTTTCGCCAGAGCAGACGCGTCTCCGCGCTTAAGCTCCGCGATCGCATCTGCCACCAACGTCGCCAT
GATGCGGAATTCAAAAGTGTGACTGCGCGCGGAATTCAATTGTCAAGAGTGATTATCGCGCCGCACTCAGATCATATTTTTGAATGGCATACAAAAAACT
GGAGGTTTGAACAGGGCTCAGATATTATCAGATATCCGCTCAGATTAAGTGGTGTGTCCTACACTACATATCTGCAGAGATCCACACACGATTCCCCCCA
CTCAACGATCGTTTGGACGCCAAAGGCCCGAGTTGCTACACTACAGATTGAGTGATGGAGACTGCAGACCTGGTGGTGGACGGCACGCGCACGTCTGGCA
AGGATGTGCGTGAGCAGAACGTGACGGCGGCGGTGGCTATCGCCAATATCGTCAAGAGCTCGCTGGGCCCCGTGGGACTCGACAAGATGCTTGTGGATGA
CATCGGCGACGTGACTATCACCAACGACGGCGCCACGATTCTCAAGCAGTTGGAAGTAGAACAGCCTGCCGGCAAGGTTCTGGTGGAGCTTGCTGGCCTG
CAGGACCAGGAGGTGGGCGACGGCACCACTTCCGTCGTCATTATTGCTGCTGAGCTCCTCAAGGTGAGAAGAAGATACTTTTTATGACATTTTCCAGCTT
ATTTACCAGGATGCAATGACGAAAAAATATTCACATTTAACTTGTCATTTGTTGGTGGCTACAGCGCGCCAACGAGCTGGTGAAGAACAAGATCCACCCG
ACGTCCATTATTGCCGGGTACCGTCTCGCCATGCGTGAGGCCGTCAAGTATATTAAGGAAAACCTGAGCGTTCCCGTTGATTCTCTGGGCCGCGAGAGCC
TGGTGAATGCCGCTAAGACCAGCATGTCGTCCAAGATCCTCGGCCCAGAGAGCGACTTTTTCGCTAACTTGGTCGTGGACGCCGTGTCATCTGTCAAGGT
GGAGCAGGAAGGCGCCAAGGGCAAGATTAAGGCCAAGTACCCCGTCAGCTCCATCAACGTGCTGAAGGCACACGGTAAGAG