Description :
From Genome Similarity Track
Location :
Scaffold_14:9038- 13274
Sequence
4236 bases(100 bases per row)
TCGTACAGCAGACCTCCACATGACAAGTCGGATGCTGGTTCCCAAGTTGGATCTTCATAACCAACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCG
TGCTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTGAGGCAATAGTTCCTC
ATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACCAACCGAGTGTTCGGTCGACTGTTGAATTCGTTGACGGCCTTGAGTCTCGACACATGCACT
ACTGGGTAAAAGCGATACCCACTTCGGTCAGGCAGTTGCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACCGGTGAG
CTAATTTCTTCGTCAAGCCCGGTTTGACGCGCTCCATGTACAACCACGCCCGACTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATCTTC
CATCTCTTCCGAAGCTTCTGGAGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGGACCTCATTATGCTTT
TTAGTCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGTCACGCTAGTGCGTCAG
ACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCGCAACGTCGACTGCGCATCCCAGCCATGAACGAGGTAGAACGGTGTTTCCTTCCTTGT
AGTGTCCTGAGAAGTATTAATAGCAAACACCAGCTTCTCTGCGATTTCATCCCAATCTTGCTGTAAAGGGTCTTCCGCGTACACCCGTACGGAGCCCATC
ACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCGAACGCTTGGAACA
CCTCGCTCATGAAACGTGGGTCGCGGTCATGCCTTATTAATGATGGGGCTCCGAACCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGC
AGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATC
ACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCAGGCGAGTATCCACGAAGCTGTGGACGGCTTTTACTCGAGCTGCAATCTG
GACAGGACTTCACATGCTTCTCCACATCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCC
TTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCGTGGTCGTACCGA
CGATTCAATTCAAGATAGTGAAGCACGCCGTCTTCTGACAATACGAACCGGTCAGCATATGTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTCTG
CTTCGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGTC
AACATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGAATGAATCTTCGGTGGACGTCTCTCGTCGTTCT
TCATGCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCTATAT
TACCATAATCGCACTTTGGTGAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTC
TGCTCCTCGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGATTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCC
AAGATGACCCAACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGGATTCTCGTACAGCGTGAAGATATTTAACTGATCGAA
GCTTGGACGTGAGTTCCTTTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCGA
CGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGCCTCCGTTTATCATTCCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGC
GTTTGCAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCATACTTCTCTGTCCTCGCTGATCCGTCAAAG
GACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCGTTCGAATAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCG
CGAGCGAGTCTTCCAGGTCGACGAAACTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCGTCACCTTCACGCGCTGCACCTTCAGGTGCCA
CTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATATAGCGTC
TTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCC
GACCGAGGAACCGTACGGGGTGTAACTTGCCGTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAGCTTCTTT
CGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAG
TCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGTGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATACCCT
TCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAAAAAGTCCACCTT
GGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGATGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTGGCCAGGCAGCTGTCGAAATCC
TCGCCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACACAGGTACCAGCGATGATTCGTCCGGTTCCCCGTTCGTAAACATGTCAGCGACGG
GGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTACCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGCCCACGACG
TTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTTCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCGATCATACGC
TGGTAGATCATCGGCGCGTTCTTTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGTGCTCGCAAGG
TCATCATGACCGCCCAGAAGCCGCTTGCTTCATCTAGCGAGCATAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATA
CTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCAT
GGACTGTCTGAAAAGACGATCAGTCCTGCTCGCAACAGAGCGCGCAGCAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTT
TAATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGAATCTGCTCGTGGTTCTT
CAGCGTCGCGACCAGACGTTCTCGGCGATCAGTCGA