Description :
From Genome Similarity Track
Location :
Scaffold_1051:9036- 10952
Transcript NameFunction/comments
Phypl_g12186hypothetical protein
Phypl_g12187hypothetical protein PHYSODRAFT_341096

Sequence
1916 bases(100 bases per row)
CAAGTCAAGACGCTGGCAAGCTTCGGACAAATACCGACCGACCACTCGACTGAGAGCGTCTGcgaagccgcagcaggcGGGTAATTCGTTGGGTACCCTC
CAGCTCAATGTGAAGTGCACTCGGCCGGCGGAAGGGCCAACGATACAACTAGTCAAGTAGCTTTGCTACGTTTACTCGTACATTCTGATGAAAAGTACTG
TTCTCGGTTAAGTCTTTGGTCTACGAAAGCTTGTTGCTAGGCATGGGCTGCAAGTACTTGACGTGTGAGTCTTACCGTTCATGGCGCTGCCCTAGTACGG
CCAGCAGATACCTGGAGGAGTTTCACGGCCAACGCAGCCATATCCAGAGTGCTTTAACGGCTCTTAGGCACGTTCTTGGGTGGTATCCTCTAGGCTAATG
GGTCGCTATACGATCTAGCCGCCTTCCATGAACGAATGGACATCGCTCCGCAAAGACGCATGGAAACTTTACTGCAGCTCAGCAAACCATTCCTCTATTT
ATCTTCTCCAGAACAAAAAGATCACTGTTCACTAGCCAAGGACATGTCAAGAACGGCCTCAAGCGTGGAGTCGACTTCCAGTTCGTTGACCGTGAATGAG
CCCCAACTACTGCCAGGCGAGCTAGTTGAGGTGCTATGCAGATATTTTACAGGCTTCGAGGCGTTCAGCCTGTCGCGAACGAACTCTTGGTGGAGGAATT
ATCTGTCGGTCAATTCTTTCTGGCTAAAATGTTTTCGCGGCTTCAGCACCTGCGAGGGTCGAGCGAAGTCGTGGAAGAAGCAGTACATTCAGTCTCGAGC
ACTGCTGTTCAAGGCACTGAAAGTCGATAACGGATCATGTCCAGTGGATTCCTTCGCCTACTTCACACATACCGCAGACCAGCGCCGAACGACGCATTTC
CAGCTCACTCACATGGGTGGGAAGAGCTTCAGCTTTGACGTGTGGTTCAGCCTGCTGCCAGCTTCCAGTGGAGATCAGTACGGAGGCGTCCTCTACGGAG
TGCAGTCTTCCAGTCCCGAAAGAGGTGAATGGCCACACTACCACCGACAGTACGTGATGGTAAGTTCGACGGGTGATCTGTACTGCTCGGTATTACCCAA
GAAACCCGTCGTGCGGAGCAACTTGGAACCCAACCATTGGTATCACGTTGCGTTGACTTACGATCACGAAGAACAGCGTCAAGACGTTTACTTCAATGGC
GTCAAAGTCCAGTCTACCTCCGGCACGTGTCGTTATGCCTGGCATTTCATGACGTATGGGCAGATCGGAACAGGTTGGAGCGGTTCTGAGTTTCCTAACT
GTCCTCGTCAATGTTACAGCGGATGGTATGGCTTCCATGGTGTCATTGATGCTTTCTGTGCTTGGAGAGGAGTACTGACTCAAGAGGATATCTCAAATCT
AGCAAAGGGAGGAGTCGTCACGAGCGCGAAGCTTCGGGCTTCTTTAACGCAGAATGAACTTGGTAGAGTTCCAGGAAAGGCGAAGCTCGTGAAATGTACT
CGCTCAACCGAAGCGGCAAGACTGCAGCTGATCAACTAAGTGGTAATGTACTACGTGTTTTGTGTGAGCATAGTACTCTTGCTACACTTGTACCGTCACA
TTTCTTGAGCGGTTAAGCCACAACAGCAAGGAAGATAGCTGCAACAGTAGTGCTCAGCATACTAATGCTACACGTAGTTGCTGCCGCGGATCCGTCCACT
GCTGTCTCAGCTTCCGTCGCCTCATTGGATGGGGTCTTCGTGCCACCAAGAGCTACGTTtcctgtcgtcgtcgcagcctGGTTGGAAGTCTCTCCGTTGC
ACGTAGGCTGCGTCGAAGCGCACTTCTGCGTCTTCACTGCACACCATTCAGCACACGCACGCTTGAGTAAAGTAACTAGATCGTATCTCGAGGTAGTTCA
ACCGATTCTTACCTTT