Description :
From Genome Similarity Track
Location :
Scaffold_62:90345- 92001
Transcript NameFunction/comments
g17425.t1KUF84077.1 ABC transporter G family member 15 [Phytophthora nicotianae

Sequence
1656 bases(100 bases per row)
GCTTGCTCACCGGCGGCCTGTGTGGAACTTCCATAGGATAAACATGAAAATGATCTGGAAGCCCACGATGTAGGCTGCAAGATACAGCATGTCCTGCATG
ACGTCCACGTCCTCCATGCCGTACTTGACCAGAATGGCCTTCGCAGCGTCCGACGTCTCGTTCTCGAACTGCTTGAACACGAAAGACTCGAACGAGTACG
AGTGGAACGCCAGGTAGTAGCCCCAGATCCAGTAGTCCGGGATGGAGGCGCGAGGCACCATGAAGCCCTCGCACAGCATGAACATGCCGAACACGCCCGC
ACCCAACGCGATGCCGATGATGTAGTGCGGCACCGCAGACCCGATCACGTGCATCATGGACTCGGACACGACGAGCGACAGGAAGAGGTTGAGCAGGAAG
TACTCGAACGCGTTCAGTCCCGCCAGCAGCACCACCAGCGCCGTCGACATGACCGCGATCACGAAGATGCCCGGCAGCGTCGCCAGGAAGTTGGCGCACA
CGTAGCTCACGACGCTCAGCGAGCTGTTGGCGCGCTCGCGAGCGAACACGGCGCGCTGCTCGATGAAGAAGGGCAGCACGGCCACCGACATGAACACCAG
GAACGCCTGCACGTAGAACAGCAGCGGCACCAGGTCCTCCTCCGTCAGCTCGTTGTTCGTGCTCAGGTACATGGTCCCCACCATGAAGCTCAGGCAGAAG
TACATGAAGAGGCGGATCCAGTAGATGCCCGGGTTGCGGATGTTGTTGAGCGTGTTGCGGTACATGAGCACCTTGAACTGCCGCAGAGACGAGGGCGACG
GCTGCTCGATGTCCGGCAGGTGCTGCAGCGTCTTGCGGTCGCTCTCGATGCGCGTGCTCAGCTCCTTGCGGGTCTCGCTCTGGGCGTAGGCCTGCACGAG
CTTGGGCACGTCCGCGTGGTCGTCGAAGTCCGTGTTCACGAGGCTGATGAAGTACTCGGCCGGGTTCATGTAGTTAGGACAATCGTAGCCGGACGACGCA
AAGTGCGGGATCATGTGGCCGCGCGGGCCGCAGTAGACGGTCTGCCCCGCCGACAGCACCACGACGTTGGTGAACATGTCGTAGACCAGCGACGAAGGCT
GGTGGATGGTGCACACGACGGTTTTGCCCTCGGCGCAGAGCTTGACGATGAACTTCATGACGTTGTGCGTGGCGCTCGAGTCCAGGCCGCTCGTGGGCTC
ATCCAGGATGAGGATGCTCGGGTTCGACAGCAGCTCGATGGCGATGCTAAGACGGCGCTTCTGGCCGCCCGAGAGGCCCTTGCGGAAGATGTCGCCCACG
AGTGTGTGGCGGCACGTGGCCAGCCCCATGGCCTCCACCACGTCGTCCACGCGGGCCTCGATCTGCCTCGTCGAGACGCTCGTGGGCAGACTGAGCTTGG
CGGCCATGCGCATGGTCTCGAGCACCGTGAAGGACCCGAGCAGCGAGTCCTCCTGGGCCACGTAGCTCGTCACGGCGCGGAACGTCTTGGTCACGCGGGC
CTCACCATTGAGTTCGATGTCGCCCGTCACTTCTCCGGAGCTGATGCGGTCGGCCAGCAGGTCCACGAGTGTGGTTTTGCCCGATCCGGACGGGCCCATG
ATGGCCGTGAGTTCTCCAGGCGCGCAGCGGCCGCGGACGTTGTCCAGGATGACCTT