Description :
From Genome Similarity Track
Location :
Scaffold_340:9034- 11005
Transcript NameFunction/comments
Phyta_totarag7309hypothetical protein

Sequence
1971 bases(100 bases per row)
AAGCGAGACTCTTTTACTCATCTCGATGCATAGCATAGTTCTCCTGGGTCCTTGGATATGTCATATTCGTGATAGTATGTTTCATCTGTGTCAAAACGTC
TTCTTTGTAGACGCCGTACGTCCTCGACTTTCGGATcgtctcgtgcagccacttgatgCCGTGAAAATGACAGAGTAGCACACGGGCCTCTGGAATCTTC
TTGTGGATGACTTCGACCTCGCGCATATCCTTGTCGACAATTACCATCCGCACAAAACGCCAATGCTAATTCGCTCGCTTGAAGTGATCTAAACACTTCG
CCATGTGCCAGTCACGATTCGTCTCGATCAAAGAGTATTGTACTGGCTGCCCCTGTCTGTACTGATCCATCGCGACCATTGTGAGAAGCTGATAGTTGTA
CCTAAACACACAAACAGTCCATACCTGGCCAAAACCTGCAGGAACCGGGCAGAAACCTGTCCAAATCCAACCTCAGCCGTAATTCACTGGTTGGTCTGGT
GCGTGCAATCCATTTGTAACACCTCCGGAAAGCTATCCAACATCGCGCCCATGTGGCCACTCGTGAACGAAATAACGCCGGTGTCTCCACGCGCGCTTTC
GTTCACTGATGAAACATTCATAGACGGCTCTTGCTTGAAGTCTACGATCATCTCAGCGACTGCATCATCATCAGACAGCCCCACGTCTACGCAAACAACA
CACATAAATATCAGTATACTCAATAACTCGTATTATCACACAAACAACTTGCCTCGCTTCCGCATCCGGCCAAACAGGTTTCGAACGCCATCCATGGTGA
CTCGGTGGTTGGAGTTGCCGCGTATGTAGTTGTAGACCTTTGAAGTTCCCGCCTGCGCGTCAACCGGTAACTCGCTTCCAGGCATAAGAGGAGACTCCAC
CGGAACCTGGCGAATACCTGGATAAGACTTGTAGATATCCTCGGTCAACGGATGTTTTTTGTGTGTCAGTAGTCTTCCCGTTTCATCGCAATACCCCAAG
TCCCGTCACGACGCTGTATAATTTAAGCCAGTATCTGGAAAGGGCAGCCAGTGATGTTTAACACGTGCGACGTTCGCTTTCCTGCCGACCTATCACGCTC
CGCCTAGCCGTGCGTGCGGATGAACTTGCGTTGAAATGGGCCCATTTAGTACGGAACGAGAGGAATCCCCATCTCTGGACATCCTCGGTAGCGTACCTGC
GCGCGGAGGCCAGCATTATGTCGGTCGATCTTGATCACCTCCTTGATTACAATCTTCTGACGCGTAGTCTCCATATACTTCTGCAAGCTGGTTGCAAGGT
CGGCTCACGAGTCATGCTGGGACTTGAATGCAGGAAGGTAAAAtagctcctcctcttccacgTCCGACAttgtcctcttcttccttgacCACGGTTCCTC
ATCCGGCGTTCCGACTGTGCATTTGGTTCCTCGTTCTCTCGCCCCCCCTTCGTCCTCTGTCTCTGTATTGTCCTTCACTTCCCCATTTTCTCCCCCTttt
tcatcctcttcctcctttgAGTCGGCTtctccctcttcctcttcagtaccttcctcttctgcttcttcgtcttctcccCATCATCTTCACTGGCTTCGCC
TTCCCCTGGTTTAGCAGAAGCATGGGCCCAAACTGCGGAGCCTGAGGCTACTGAACGCGGGCTAACGCCTGCGCCTTCTATGAGCATGTACGTGGCCGTG
TGGCGGGGACCGCCTTTTGCCTGCGTGTTTCTTCCTCTGCGCGAGCTTGCTCAGTCATCTTCGCCTTGATCTGCGCCGTCAGGGTCGTGCGTGCCATTCC
TGTTGTCGCCCGCGGGAAGCCGCGTGGCACGATCTCCCCTCCTCCCTGTTAGTGGTTATGAGGCAAAAGAACAAATGACGGTAATAAAAACGAAATATAT
TCTACCTGGAAATGCCTGTAAGCACAACTGGATTATACCTGCTGGGTAACACCTGGACCCAAATCTTGCCG