Description :
From Genome Similarity Track
Location :
Scaffold_134:90336- 96221
Sequence
5885 bases(100 bases per row)
NNNNGGGCGGGTGACTATCGGCCGAGTACCCGCCTGTCACTCCCAGACGCCAGACAAGCCCCCACTCGTTCACGCTCCTCCATGGACATTGCCCAGCGCT
CAGCACATGTCAGAGGATCACTAGCGAGTCTTCAAGAGGCCTTGCTAGCATCCCAATGGGCTCTAGAAATAGTCTCGTCGCTCGACTGCCGAAGTCTGAG
TTGCAAGCCATTGCTCGTAGATTTCGCATTCACGCTGAAAGAGCTCGCGGTCTCTACAACCTTCGTAGGCCAACACTTGCCAGTCTTGGTACTTCTTGGA
CTCCAGACGCACATAGCCGTCACCTCGTGGCAAATCCCCATCTGGAATCCACATCGCGATCGAGTCGTGTGCTGGTAGGTACACAGCACGTTGGTCAATC
GAATGCTCTGAGGCCGTCCACGTCGAAACCTCGTCACTGACGGGATTAGCTTGTTCGTTCGACGAACCCACAGTACGTGTTCTTCCAGCCCGACTTGACG
CTTCGCTAGTCGATATTCTCGCCACTCGTGCGCTTGAATGTCCAACCGCTCGGGTGGCCCGGCGTTAACATGGGAGCCGTATTCTTCGCTGTCGATCATG
TTCTTGGTCTTTATCAGCGGGATTTGGACTTCGTGCGGTAATTGCGCCGCGCCGTGGAACAGGTCCAACCGGATCCCAGCTGGGATCATAAAGTCGGTCC
CGAGTACCACGTCGACGCCTGCACTATGCGCCATTACCCACATCTCAAACTCGTACATCATCTCCCATCCGAGCGTAATCTTGACGCACGCTCGTCGCGT
CGTAGACACCTCGCCTTCGTTGATTCCTTGAATGTCAATGCGGCGTCCGTGATCAGGTACATCTCGGAGTCGCAACTTCTTGGCAAAGGCGTCAGTGATC
ACACTAACGTTCGCTCCTGTGTCGAGGAGGATCCTCGTTCGCTGGTCGTTCACAGCGCCTTGCACCAGAGCTCTCATTCTGATCCGTCGGTCGAATTTCT
TGGCCGACCACCACCCCTGTCTCTCGCCAGGGTTCAACTTCATCATCTTGGAGTGACCCTTGGGCTCGTCTCGCGCTGCACTCGAAACCAAGCCGAACGA
ACCCTCGCTGGTGCCCTCATCAGCATCAGCACACTCCACTCTCTCTCCAACACCTCCACCGAGGATTCTACTCCTCTTCTTTTCATTTTCCGTCGCGTTC
ACACTTGTTACGTAATTATCAGGCCATTCACTCTGCCCCATGAAAGCAAAGATACACTCTGCTTCCATTGAAGGCTCGGTTAACTGTGGCAGCCCGATAG
GGACCAACCAAGCTTGTAGTTGACGGGCTGCCTAGTATAAATGGACGTTCTTGACGACGGCCTTGAGCTCTGGCGGGAGTTCCTCCTTCGTGCCTTTAGT
GCGCACGAATTTGGCAAGGTCTTAGAAGTTGCGGAAAAGTTCGCATTGTCCAGCATCGTGGAGCTGCTTGCAGAACTACCATCGCTTGTTGCAGTAGTGG
GCGGAGTGACTCATGCCACCGCACACCGCGCATGGTCCGTACTGTGGGCGTCGGCTGTCGCGGTTGGAGTCACGTCGACCGCGTTGGTCCTGATTGAGCC
CACGGTCACTACTTCGGCGATCTTGATTGAAGCCATTCTCGCGATCAGGCACGTTTCCACGCAGTTGACGGTTGTCTGAACGTGCGTAGGGGCCTTCAGC
AGCTGCACGGCGTTCATTTTCGTTAGCAGCGTCGAGGTATCGGTCATTTTCATCCAATGAGAAATCACCATCCGTATTATCGGGCTGAAAGTCGTTGTAC
TCGTCTTGGACATTGTTGTAAGCGTTCGGATCTTCGTTTGAATACTAGGTGCCTCCCTGAGCAGCTTCACGACCTTCTAATTCAGCTAGTAGGTCATCCA
CTGTGGCTTCAATGAGCGTCACTCTTGGTTTGTTTCGGTTGTCATCGCGGCGACGGTCATCACGCCGGTTGTTGCGGGCGAATCCATCGTCGCGTCGCGT
ATCACGACTCTTGGAGTATCGGTACTCACTGTCACGCTTGGCCATCCTCTCCTTGCCCTTGAGAACATCTTCGATGATCTCTTCGAGCTCGTGAATGTCG
GCGACTCGAGCGTGGTAGAGACTCTCCGCCAGCTTGTCATCATCGCATGTGCCAGGAACTGCTGTACGTGTTCTTTCGCGTCGCGACCACTCTTCTCGAA
GTGTAGACGGGCGGTCCGAGCATAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCATTACGTTCCCGCTTGGCGGAGTAGTAACGCGACAGTGCC
GTCTGCGTGAACTGCGAGCAGTAGTAGCGGATGAACGCGTCGCTCAGCAGCTTCCACTTGCGCTTCGTCTTCTTCGGAAGCTGACGGAACCAATGAATGG
CTCCGTCCCGGAGACTTAGCTCAAATGGAATGCACCATTTATCGGCATCTGTGTGGGTTCCAGTCATTTCATAGACGAACCCACGGAGCCACTGCATACA
GTTCTCGCTCTTGTTGCGAGAGCCTGAGAACGGCGTGATGCGATCCAGCGGTCGGTGCGAAGCCATTTCAATCCTCGGTGTTGGGTCCACGTCGTTCAGC
GTCGCTAGCTCATTCATCTGACGCATCAACTCGAGTTGAGGATCTTCCTCGTCGAATGTACGCACCAAAATGTCATCGTCACTGGACGAACCATCGCTGT
CGACTTGACGACGTCCGGCACCACCTTTGGGAGCTCGCGCACCGCCTCGGCGACCGAGCGAACCCTCGTTACTTGCGTAAATACGTTGCATACGGCTCTC
CGAACGTGGCGTAACCATGTGCGAGTCTTGAAAGTACGGTGAAGCTTCGGTAGTGCCAAAGGCACCACGCTCAGCTCCACGCTTGGTCGGAGGAGTACGA
ACGAGTCGTTGGGGCGTCGGCGGCAGTGGAATCTTAGACGGATCTTCATCTTGAATCATCGGTCGACTCACAGGCTGCTTTCCGGCATTGATGCCAACAA
CGCCAATCGCCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATGTGGACTCCAATCCTGGAGCGACATCGTCGATGGGTACGTCTC
GTTCTCGAACCCCAGCGACAACAGTAGCGAAACTGAATCCTCGGCAACTTGACTAGTCGAAACCGAGTTGACTGGGTATTGAAGTTCCTGCGCAAGCGCA
GGCCAGTCGGCCTTTTTCTTGGGGATGGGCTTGAACAGCTGTATCCACTCATCATTCTGCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTG
GTGTATCACCGTTGATAGGTGGGCGAGGTGCCTTCAGCAGTGCTGAATGCTTTGCACTCGCCACCGAAGGTTTAAATCCCTCGGTCCCATCGTCATAATC
ATCATAGGCCGGTTCCGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGCTCCTCGAAAGGGACTTGGTCGCCCCGCTCAGCCCCGATGATAGCGTGGCC
GTCTCCGGCGTCGCTGCGCCTGGCTCTGGAGCCGGCGTCTTATCTTCGTAATCTTCATAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGAAGC
TCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCGCAACCGGGCATGAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGCGTAACTGGTCCCGTCGGTTG
TCCTTTCGCCATGTTTCTTGTCTTTTTGTTGTTCTTCTTCTCCTGGTAGCTCGTAAACTGGAAAGGCCATACAAAACAGTTCACAATGGTCACAATCTGT
TCCCGTGTCGCGGCACCAGTTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAAGATGTTCTCACAACAATACGTCTACTAGGATAG
TAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAGTAAAATAA
GAACACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCA
CCGAGTGTTCAACACTCGGCTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCCC
GATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGC
TTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAA
GAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCCGTTATGGATCTTCTTGCATGCCAAGCGTCGTCTGCACTGTCGCATGAGCATCTTTAA
CGGTCCGCGCCCTGTCCCAGACGGTGAACGTGTCTTTCAAAGGTCGCTGAGTATTCCGCGAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATG
GTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAGGGACAGCCTGGATTCAGTGACATAGGGCCGTATCCGATACTTGTTGAAAACTCGGAGG
TGACGCCGTCGAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCCGACCGAGGGTTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGG
GTGATAATCCGCAACCACAAGGAAATCTCTACACCACAATAAAATATACTGTGCTCAAGTTATGTTGCGTTGCAACAAACGATGTACACAATATCCTTAG
TGTTTACGTGTTTTACATCACCAATTGCCTGTCAGCCTACCTCTTGTATTATTTGAAGACATTTTTGACACCTTAACTTATAAAAGGTCTGCGTGACGAC
TGGCTGTTACAAATAGATACCCGCGTGATGGATGGCTATTGTTAAGCATCATGGTACAGGTAGACGTGACAGTAAACTATTGCGAAGATGAAGTCTTCGC
CGTTACCACCGGGGCTATAAGTCATCTGCATGATGAACACTGTCTTTCCCTAAAAGATTTTGTCTTAATTCTCGGCTGAGCGCTTCGCTCCTGAAATGCC
ACACTTTCAGGTGCGCTTCATTGCAAAGTTACTTTCGGTTATTTAAAGGGTGGATCAGTATTATTGGTGCGCCAAACCTCAGCATAAATCGGTGAGGAGA
TCTCAGATAAGTTTAGCGCTAGTAAATACGACGACCGAAGTGTATTGGGATACAACGACATCGGGTGAATTGAGTGACGTGTACTATTTGTCTAGCCGAG
AGGTATTCTATACCATATAGCTGATTGCGACGGTCCGTTAGAGCGAGTTTTGTCTGTCTCTGCATGCATATTATTGTTTAGAGCCGCTAGTATCTGCCGA
GGGTCACAGAATATACCAATTTCGCCTCTCCATATGCCTCGCTGAGCTCTTCATAGTATCATGATATCAGTGAAGGACCTGTACGTGATGTTCGCTGACT
CGTATCAATTAAATTTTAATCTCATAACCCTTCTATGATAGGATGAACGCCATTGACTTACTTACCGACTTATTTGCATAGCTAATGATTATCAGAGATC
CGTATATCCTTTCCGAGTGACATTTACTGGCTCCGATAGGTATGGCAAGCATACGAAGCCACTTGGCTGTAGGCATATTATCAGATCGTAGTGATACGTA
GACTTGTATCGAATAGTAGCCCGTGTACGTTACATAAAGTACTTTCGCTGTCTACTTTTCAGTTCGGCGTGCTATTTGATGTGTC