Description :
From Genome Similarity Track
Location :
Scaffold_53:9033- 12307
Sequence
3274 bases(100 bases per row)
TTCTTTGCGGAGTACAACTTCCCCGTGGAGTACAAACCTGGACGACTCAATATCGTCGCGGACGCGTTGTCGCGCCGACCCGATTTCGAGTCGGCTGCGT
AGTCCAACAGTGAGATTGATACCACTGTTGCAACACTAGTCACTAGTGTTCCGTCGTCAACATGCTTGACGACATAAAAAAGGCCTACGCAGAATATAAG
GCTCCTCTGCGACTTATGGATCATCTGGTGACTCCATCTCGTAAATCCCTCAAAGATTTACCGGCCTTGTATCAATCTTCCGCGGATCAATACACAACAC
GCAACGAGTTGCTATATTATACAGCCGTTACCGGCGACACACCTCGTGTATTCGTCCCCACTCATAATGATTTGCGCTTACGCATCATGTATGAGTGTCA
CGATGCACCAACTAGTGGGCATCGTGGGCGTGGGAAGACTTATATCACGGTAAGTCGCGACTTTTACTGGTCCCTCCAGTATAAGTTTATGCGCAAGTAC
ATTCGTGCTTGTGAAGTGTGCCAACGGGTGAATCCCAGTCCTTCATCCCGTCGCCACTACAGCCTCTACCAATCCCGCCAGAGTGCTGGCAGTCCTTTTC
AATGAACTTCGTCTTCGGTTTCCCAGAAGACGATCAAAAGAATAATGGTATTCTTGTGTTCATAGACAAATTCAGCAAGATAGTACATCTTGCTCACTTA
ATGAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTATTCCGACTCCACGGTCTACCCCGTGAGCTAGTCTCTGATAGAGATCTTCG
GTTTACGGCGGCGTTTTGGCAATCCGTGTTCTGATCCCTCCGAACACGTCTGACTTTGTCTACTTCTGACCATCCCGAGACTGATAGTCGGACAGAACGC
GTCAACCGCGTCCTCGAAGAGATACTTCGAGGATACGTCCAATATTACACAGATTGGAGCGAACTCTTACCGATGGTTGAGTTTGCAATCAACAACTCCT
CGCATGCATCGACAACGCATACACCATTTTTCGTGAACGGCTTACGCCATCCACGCCTATCCACCCATTCAGGGTGTGACACTAATTCAAGGAGGGGAGG
GATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGTATCGAGGTACTCGACGACGCTGACGTTGACGATGTCGATCAAATCGATATCGAAGAA
GATAACCTCAGCGATAGTAGCGACACTATTGCTGACCCAGATGAGGATGACGATGCTGGTATATTTAGCATCTCCAATGACTACACTAGCGAGGATGAGA
ACACCCTCGCTGAAAAGATGATGCCCCCTAGGGGGGCGCACAAGGCGCACTGCAACAAACCAAAGTGAATCAGCAGACAATTTCCTGCTGGTACGAGAAG
TAGTGGTCCGTTTCGTGCAAGACTCCATAGCTAACGTTGTGGACCGACAGAAACGGAACGCTAACAATCATGGAAGAGCAAACGTTCTTCTAGTTAATGT
CGGATACTTAGTTCTACTGTCTAGTAAATCTACCTAAGCACGTAGTAACTAATGTGGGTAGTAGTAAAATACTACCCAAGTACATCGGCCTGTTTCGAGT
ACTACATCGCAAAGGCAATGCGTACACGATCGAGTTGCCTCGCAGGATGCGTACGTATCCTACGTTTTATGTCGGTCGTCTCCGCCCGTAACATCATCAC
GAGTTCTCTTCCTCGGGCGAATACAACCGCCACGCTCAAGAACCTCCAAGAGATTCTTTTGGTCCCGAGCCAGCTTCTCAATCTGGCTCTGTAGAGCGGC
ATGCTGGGGACGAATGTCAGTCACTTTGTCGCGAAAGGCTTGACACTTCCGATCGTTCTCCAATTGGTAGAACGCGAACTCTGATCGGTCGTCCGATCGA
TAAAGGTAGATGCGTTGCACCCACACCTCCAAAAAGTGACTATCCTGTCTTTATTGTTTGGTGCGATCACACAGATCGTGTAAGCGTTGCTGGAGACAAC
CAACCTCCGCCTGCAACTCCAAGGGATTCGGAGTTGATCTTCCTGCCCCCACCACAGCCATTAGTGGATTCGCACAGTGGTCAACACTTTCACGTGGAGC
GTATCTTGAATTACGGTGACTTGAAGGGGCAGCAAACGAGTTATCTTGTTCGCTGGTGCAGCTACCCGCCGTCGCACGACAGCTGAGTGTCTCGCGCCCA
GCTGATGATTGACGTTGAAGGTTTCGTCCACCAGTAAGACGAGACACATCCGATGGATCAGAAGGACCATCGGAAAACACGCGCCCATGGCGCTGGTAGA
CCGATTGCAGATTAGCAATCGCATCGCGCATCTCAGAAGAGATGTGCTCCCTACCCCGGGGCAAAGAAAGGGAGTACACCTACCTTTGGATGCGTTGAGT
GTTGTCGAAAAAACACGAACACGGGTCTCCCCACGTGAGGCATGGAATTCCAGCCTCACGAGACAGATTGTGCAACTTGGCTTTTGTACCAGTTAAGGTT
CGTTTCTCAAACCTGACACGAGCTGTGTCAAGTTTCCGAAGCCAAGCTTCGCGCCCAATGTGCTGCACATTGAGTATAAAGGCGTTCCACGCCTGCAGCA
ACGAGCTTTTGTCTCTCTTAGTGTTGCCACTATACCAACGATGCTTCAGAAAAGCATCCAGATAGAAGTATTCTATAGCGCGACAGTTACTAGCGCTGAT
GTCGAGTCCGTGTATCTGCCTCGCATCGAAGAATGGAATTCGATGATGGAGACTTGTCTCTCCTGACAGGTCATTCACAAGCCTTTCTGGTAATACCCAA
GGCTTGTGTGTAGGGGCTAGACGCAGCACATTTCCGTCTAGAGCCTTCTGCGTGGTATCAACGGAAGTCTTGGTACCACTAGAATCGTCATCACGACGGT
TCAAGTCATCAACACATTCGCTAGAAGGAGAATGCGGAGTAGTAGGCGCGGGTGATAAGTCAGCATGCTCATCCTCCGAACTAAACAGACTCCGGTAGTG
ACCATGGGTCTGACGACCCGCTCGAGTCCTATTCGTAGGCTCGTATTCGGTCGCCTTTATAGACTCGGGTGACCTAGGTGTCTTCTTTAAGTCGGACCCA
CCGTCCGACTTCCCCGAGTAGATAAGCTCCACTTGAAGGCCATCATCATTAGCACGTGGTGACTCACCACGTGTATCTGCAGCAACTGGTGCTGCAGGAA
GAGTTGCAGCGGAAGCAGACGAAGCATCGTCTGCCGCGAGAGGCTGGACATCGTCAAGAGCAGCAGCTTTCGCC