Description :
From Genome Similarity Track
Location :
contig_9:90327- 91879
Transcript NameFunction/comments
g2587.t1hypothetical protein

Sequence
1552 bases(100 bases per row)
AAGGTGGCGCGCTTCGGCATGGCGGCGAGGTGAACATTTGGAGTCGCGAATACATCGGCATTGTCGCACAATATGCCGCTGTGGGCATGATCTTTGGTAC
GCTGCCCGGCACAGTCTATCCATTCTTCTTCAACTACCTCAACATGGAAGGCACACAGGTCGTGTCGGCTGTGGTTCTGCTCAACATGCCGTGGTCGTTC
AAGATTTTTTACGGCATGATCACCGACTGTGTTCCTATCTGGGGCTACAGACGTCGTCCGTTCATGGTCATGGGGTGGACGTTGTGTTTTACGATGCTAG
TCGTTATGGCCTGCATGGATGCCGGCGACCCTTATTACCCAGACAACAAGTACGCGACGATGGATGAAGAGGAGCTGACCCCTGAACTCGTTGCGACTTT
CAACGAGTCGGCACACCACGCGGGTGGGAAATTTATCGCGTTGATGATGATCGCTGCGGTGGGGTACGTCGGAGCCGATGTTGCTGCTGATGCTATGATG
GTGGAAGTAGCCCAACGCGAGCCAGAGGCTACGCGAGGATACACGCAGACCACGATCTACATGGTTCGAACTGCTTTCGTGACCATCGCCAGCATTCTCA
CTGGTTTGGCTTTCAACGGATCGCACTATGGAGGAGACTTCAACTTCTGCCTGTCCTTCCCTCAGTTAATGGTGATCCTCAGTGTTTGTTGCTTCCCCGT
GATTCCTCTCTCATGGTACTGCATCAAGGAAGAACATCACCCAGGCGTGATTTTTCGCGACTACTTGGCCGAGCTCTGGTATCTCATCCAAACACGCCCG
ATGTACCAAGTGATAGCGTACAAGTACTTGGCCGGCATTTTCGAGAACTTCACCATTACATGTGCAGACCCGATGCAATCGTACTGGGCAGAAGTCACAC
CGCTGAACCAGAAAATTATGACAATTGTGAGCAACGGCGTTTTCGCCATCGCACTGTACTATACTGGCAAGAATGGCCTCCACTGGAACTGGCGAAAGAT
GCATGCTATCACCATTGTCTCGGTGACAATCATGGACTTCATTGTAACGATGCTCACGACATGGAATGTCATACGCAACCAGTGGTTTTGGCTCGGAGTG
CCCGTGGTGGAGAACCTTCCGAATGGCATCTCTTTCGTGATCGGAACGTACGTGATCGTGGAGCTGGCCGGTGAGGGTAACGAAGGTGCTGTGTACGGAC
TGGTGGGATCGATCTCCAACATTGCGATCCCCCTGGCCAGCACATTCTCCAAGAACGTGGGCAGCCATTTCGACGTGACCAACGCCGATATCGTCGAAGA
CTCGACCCACGTGCGCTGGGAGGTGACGTACGTTCTCATCATCCGTTACTCGATGAACTTGGCCGGACTTCTTTTTCTCCCGCTACTGCCTCGCCAGAAA
GCGGAGACGCAGCAGCTCAAGCTCAACGGCGGCTCTAGCCGTATTCTGGGGATCGTGACATTATTGTACTTCATCATCTCGTTGGGCTGGACCGTCATGG
TAAATATCATGAGCATTTACCCGTCCACATCGTGCCTACCGATCGCTGGTGG