Description :
From Genome Similarity Track
Location :
Scaffold_171:90316- 94508
Transcript NameFunction/comments
g9941.t1hypothetical protein
g9942.t1XP_008894180.1 queuine tRNA-ribosyltransferase [Phytophthora parasitica INRA-310
g9943.t1RAW26038.1 hypothetical protein PC110_g17551 [Phytophthora cactorum

Sequence
4192 bases(100 bases per row)
CCAATCACTGATCATATTATTTACGTCCATTCACCAACAGGTGGAGCGTTGGGACGAGCAGCGCGAGGAGGGCACGTTCCAGGGCGTGCAGTACTTCAAG
GAGGAGTAAACTCTCCCCTTCGATCCTGTGCTCCTTCTACTTGCCCTCATGCGGAGGTTGAGAGGCTGCAGGTCGCCTTGTTTCCTATATATTGAAAAAG
TGTAGGAAAACGACGTCCTCCAACAGGCTCAGCGACCATTTCCGACAGCAAAAAGTAGTCACTTCCAAATGAACTTTTTTGCCGTCTTGTGGCAGCTTTG
CCATCGTCGGCCTCCGCATGCGCCAAGTTCATCATTAAAACCTGCAAATATCAAAACAACCGTCGTCCCCCGCTCGTTTCGACGTCCCTGGGCCAGTTAT
GCCTCACGTCATGTTTCTAGCACATTTGCTATTCTAGATGAAGATGCCGAGCGCTTTGACCTTCGAGGTGCTGGCGAAACACCATCGAGCGCGCGCTGCG
ACGCTCACGTTGCCCCATGGACAAGTCCGCACGCCGGTGTTTATGCCCGTGGGGACGCAAGGCGCCATCAAGGGACTGACCACCGCACAGATGCAGGACG
TGGACTGCCAGATCTTCCTGGCCAATACCTACCACTTAGCGCTGCGTCCGGGCACGGACGTGTTGGCGCAATTGCCCGGCAAACTGCACGAGTTTATGCA
GTGGCCCCGCAACCTGCTGACCGACTCGGGGGGGTTCCAGATGGTGAGTCTCTCGAAACTCTGTGAGGTGTCGGAGCACGGCGTGCAGTTCGAGAGCTTC
GTGGACGGCTCCACGATGGTGTTGACCCCGGAGGCGTCGATCGCCCACCAGAACCGCATTGGAGCGGATATCATCATGGCGCTGGACGATGTCGTCTCGA
GCTTGGCCGATGACGACGAACGGTTTAAGGAGGCGTGTGGACGCACGGTGCGGTGGCTGGACCGCTGCATCGAAGCGCATGCCCACCCGGACAAGCAGAA
TCTCTTTGGTATTGTGCAGGGTGGACTGGATGTGAGTGAAGGGGGGCTACGAGACCAATGTCTGAGTGAACTCATCAAGCGCGACCTGCCTGGATATGCG
ATCGGCGGATTGGCCGGAGGTGAATCCAAGGAGGCGTTCTGGAAAGTGGTGGCGCGCTGCACGGCTCAACTGCCGGAGAACAAGCCTCGGTATTTGATGG
GGGTTGGCTACCCGCTGGATCTCGTCGTGTGCTCTGCTCTGGGCGTGGATATGTTTGACTGCGTGTACCCGACTCGCACGGCGCGGTTTGGCACGGCTAT
TGTGCCGTCGGGGCTTTTGAAGCTGAAGAGCGCCAAGTGCGAGGAGGACGAACGACCCATTGACGACACGTGCGAGTGCTTTGTGTGCAAGAAATACACA
CGTGCATACTTGCGAGTGCTGTTGAAGAAAGAGGAGACTTTCGGTGATGCAGAGGAGACGACGGGGAGCATCGGCGCACACCTCATCACGTACCACAACG
TCACGTACATGTTGAACCTCATGCGTCGACTGCGCCAGTCTGTTCTCGATGGAGAGTTTGAACCGTTCGTCCGCACCTTCATGCTGCAGCAATTCCCGAA
CCGTGACTACCCTCAATGGACTGTGGACGCGCTCGCCGAGGCAAAGATCTCGCTCCATTGAGGCGTGCTCCAGCTAGACAAGACGTCTGCGTCAAGGACT
AATGCATCAAGTACTATCCAGAAACCGCTTGCTTGGCTGTTATTATCATTTTACTGTCATCCCCTTCGTCTTGTCAAAGGCACTTCACTACACTTACACT
GGAGAAATTCTAACACTACGACGTCTTTCTCCTCGTACCAAAAGCAGGAGACTATCCGCCTGATATCGGAGTCTTGACGTGGGGAACTTGTCTTGTTGGG
TTCTTGGCGATGAAGACGCTTGCTACTCTACGTCAGCTCTGTACACGCACACAGCAATATGAAGAGTACATACATATACAGGAGGCGGGCTGGCTGCCAA
AGTGGCATCATTCTTGTCGATGCACTTGTTCTTGGCCGGACCCTCCGAATTGGTTCGATGCTTGAATGTTTTGGTTCGTATGATATCTCGCTGAGGGGGC
TTTAAAAGCGTGGGTTGTGAGGCATTCCTTCCATTGGGGATAACTGACCTTGCTGCTGTGGCTGCAGGAAAGGGTAAGACCCTTCCGACCCTGACCCACT
GTGCCCCTGTTGCGAGTGACTGTAGCTTGGTTCATTCCACGATTCCGACGAGAGTGTCGTGGAAGTCTGAGGAGGCAGATTGTCGTCCAGCCCTGCGCTT
TCGAGCAGTACATCGATATAATCCCTGGCCTCTTCATGTTGATCTGACTCCTGCTGCTGGTACGGCACCCGTTGTTGCTGCGACTGGTATGGCTGGGGAT
GAGACATCGGTGGACGTTGGTGAAGCTTCTGTTCGCCGTCCGACGATGCACGAGAGTAATTCAACGAGCTTACGCCGCCTTGGTACGGCGCATTTGGGTC
TCCAAACTTGAACGGTGTCATCATCGAGTGATTCTGCTGAGGCGGGTAGGAAGCACTGGTATTACTAGTTGAGGATGGGTTTGCATTGATACAGGACGGC
CATCCACTGCAGACTTCAGGCTTGACAGATGCGGACCATTCATTGCCGGACTCGGGCTTGACGCCAAGCGACCCATATCCAGAGCCTGCGAAGATATGCT
GCTGTCGATTCATCTGCTGTCGTAATTGCTGCTGCCGCTGTTGTTGTTGTAATTGATATGTATCTTGGGCAAGCGAGTTGGAAGAAACAGGGAGCACCAC
CGAGGCGTCATTCTTGAGGCTTGAGGCGAATATTGTCTGCTGCGACCCCGACGTAGCTGAGGACGACATGAATTCTTCCAACTGGCTGATTGTTGGCGCT
TTGCTGCCGATGTTAAAATCGGTAAGGAGCTGATCGCTCCTGCGTCGACCAAGGTAAACGGCCCCACGAGGGGCAAAGCTACCATTCCCACCCACATTCG
GCATGTTCATAGCCATACCCATGCCAATGGTAGGCGGCACCACATGGGGAAGGCTTTGGCGCTTCCCACGCGACGACTGAAACGGATAACCCTGTGCCAA
TTCCTTGGCCTCGGCGATTTTGCGCAGGTACATCAGTTGTTGCTGCGCAGACGACGCGTTGGCCGCAGCACCGGATCGAGCCTCCATCTCCAGCTCAAAC
TCCTGCTCTGCGGGCGTTCCGGCACGCTTCCGACCCGGTGCCGAGGCTGTTGCTGCAGCAGCTGCCGCTGCCGCCGCGGCAGCAAACCCAAATGCTTCAG
AGCCAGGAAGCATTCCTGTAGAGTGGCGACGACCTGCCGCTGCAGAGTTCAGGAACGTCACTGTCGCTCCAGAGAGCGTGTTGGATTTCTGTCTCTTGAG
GGCTTGCTGCGTCGGCAGTTGATTTCTCGCTTCGGCCAGATCGTGGGCTTCAAACTGAGCCTGAGCTTGAGATAGTTCTTGTTCCCGAGCCTGTATTTGG
TTCATGATGTGGATCGGGTTGGACGATATCGCGGCTGCCATGGCCGCCGACATGACTGCAGGGTTGGATCGCTCCTTCCTCTTAATGAGCTTCATCCGCT
CCTTGTCCGCCCTCAGGAAGAACGGGTGGCTGAAGGTGCAGATGTTGGTCTGCGTCTTGGTCCACTTCTTGAAGCCAAAGTAGTTCAACTGCCGCTGGAA
GCTCGACACCTTGTTGTGCTTGAAGTACTTGGGCAGGATCTGGTTCGCCAGCTCTTCTGGTTGGATGATCTGGAAGGCCGTACCCCCATGGGACCACGTG
ACGATGCCCGGGTCCTCCGCCTCCAGGATCTGGAACAAGAAGCGGAGGAACTTGGGCACTCCCACGTTGCGGCGCTTGATCACGTGGACTTCCGTCTTGA
CAGCTGCTGCATCACCAGGTGGCGTCTTGTCTTCGACCTCCTGCTCCTGCTCGGGCTCCTCTGGGGCCGCAGATGGCGCCACGAGCGACGCGCGTCGCGT
GGCCATCGCCTCCGCGGCGCTCCCTGGCTCTAGACCCTCGGTGAGCTCCGCTTTGCCGCCGTATAAGGGGAAAGGTCCGCTGTCCAGCGACTGCGAGTGC
GGGCTGCAGAAGAGCGACGACGTGGAGCTACAAGGGGGACGCATACGGCGGTGCTCGCGATCTCTCTCGCCGAGCATTCTGCGTTGTGCATC