Description :
From Genome Similarity Track
Location :
contig_9:90313- 91866
Transcript NameFunction/comments
g2744.t1hypothetical protein

Sequence
1553 bases(100 bases per row)
AAGGTGGCGCGCTTCGGCATGGAGGTGAGGTGAACATTTGGAGTCGTGAATACATCGGCATTGTCGCACAATATGCCGCTGTGGGTATGATCTTTGGTAC
GCTGCCCGGCACAGTCTATCCATTCTTCTTCAACTACCTCAACATGGAAGGCACACAAGTCGTGTCGGCTGTGGTTCTGCTCAACATGCCGTGGTCGTTC
AAGATTTTTTACGGCATGATCACGGACTGTGTTCCTATCTGGGGCTACAGACGTCGTCCGTTCATGGTCATGGGGTGGACGTTGTGTTTTACGATGCTAG
TCGTTATGGCCTGCATGGATGCCGGCGACCCTTATTACCCAGACAACAAGTACGCGACGATGGATGAAGAGGAGCTAACCCCTGAACTCGTTGCGACTTT
CAACGAGTCGGCACACCACGCGGGTGGTAAATTCGTCGTTCTCATGATGATCGCTGCGGTGGGGTACGTCGGAGCCGATGTTGCTGCTGATGCCATGATG
GTGGAAGTAGCCCAACGCGAGCCAGAGGCTACGCGAGGATACACGCAGACCACGATCTACATGGTTCGAACTGCTTTCGTGACCATCGCCAGCATTCTCA
CTGGTTTGGCTTTCAACGGATCGCACTATGGAGGAGACTTCAACTTCTGCCTGTCCTTCCCTCAGTTAATGGTGATCCTCAGTGTTTGTTGCTTCCCCGT
GATTCCTCTCTCATGGTACTGCATCAAGGAAGAACATCACCCAGGCGTGATTTTTCGCGACTACTTGGCCGAGCTCTGGTATCTCATCCAAACACGCCCG
ATGTACCAAGTGATAGCGTACAAGTACTTGGCCGGCATTTTCGAGAACTTCACCATTACATGTGCAGACCCGATGCAATCGTACTGGGCAGAAGTCACAC
CGCTGAACCAGAAAATTATGACAATTGTGAGCAACGGCGTTTTCGCCATCGCACTGTACTATACTGGCAAGAATGGCCTCCACTGGAACTGGCGAAAGAT
GCATGCTATCACCATTGTCTCGGTGACAATCATGGACTTCATTGTAACGATGCTCACGACATGGAATGTCATACGCAACCAGTGGTTTTGGCTCGGAGTG
CCCGTGGTGGAGAACCTTCCGAATGGCATCTCTTTCGTGATCGGAACGTACGTGATCGTGGAGCTGGCCGGTGAGGGTAACGAAGGTGCTGTGTACGGAC
TGGTGGGATCGATCTCCAACATTGCGATCCCCCTGGCCAGCACATTCTCCAAGAACGTGGGCAGCCATTTCGACGTGACCAACGGCCGATATCGTCGAAG
ACTCGACCCACGTGCGCTGGGAGGTGACGTACGTTCTCATCATCCGTTACTCCATGAACTTGGCCGGACTTCTTTTTCTCCCGCTACTGCCTCGCCAGAA
AGCGGAGACGCAGCAGCTCAAGCTCAACGGCGGCTCTAGCCGTATTCTGGGGATCGTGACATTATTGTACTTCATCATCTCGTTGGGCTGGACCGTCATG
GTAAATATCATGAGCATTTACCCGTCCACATCGTGCCTACCGATCGCTGGTGG