Description :
From Genome Similarity Track
Location :
Scaffold_124:90311- 95588
Transcript NameFunction/comments
Phyin_T30-4PITG_20143Putative uncharacterized protein
Phyin_T30-4PITG_20144Secreted RxLR effector peptide protein%2C putative

Sequence
5277 bases(100 bases per row)
TACCCTCTGTAAACCGAGCGGAGCCAAATAACTTTTTCGATCAGGTTCTAGAAAAGCAGTAGGCTTTAAGACTGACAAGTATTTGCTCTAGTATTTCACT
GTGACACAGACAAAGGCGATCGAGATGGAAAACTGCAAACGCTTGCAGCTGTTTAACGTTGATAGAGCGAAAGCAAGACATTTGTTCTTGTACTCTACCG
ATCTCCTCGTGCGTCTATTAAACCTGCTGTCTGTGGCGCTAGATTAATGCGCTCAGCAGTGCCAACACACGACGCCAACCTTGCCGTCACTCTCACAATT
GTCCCTCCCTCACGGTTGATTAGTAATACTTCAGCTAGTCGAGCGTTAACGACATCTGATTGGTTCATAAAGCCCGATTACGCAATCTTTGGAAAAAATA
GTGTCGTATTAACTAATATTATGTTGATATTTAATAATATCACATTGTCTCAGAAGAAAATATTAGGTGATATTTTTTTATATTATATGGTATACAGGTG
ATATCTTCAACGATATTAACTTCACCGATTTTGGAGTAACCATTAATCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATGGGTGCTCGGCAGCGGTTCTTAAGTGATCTTGTGCGTATATTTGTCCATGTTCTCATCTATTGA
TCACGATGTCACTGGAGAGTTGAAGGTGCACTCGGCCAAACGGAAACACTGGAAGCAAATGATAGTGTTTGTAGTGGGGCGACGGTCTTCAGGACCTGAC
CACGCACTGTGCTGGCGGCCGAGAGGTTCCAGCAGGAGCTGGCGTAGAATAAGACTCAGAGGTCGGAGACTCGAGGCATATACTTAGACAATGATGTAGG
AGTAGCTGGAGAGAGTCTCAACTATCTCATTCTGGATTTTGCAGAGTACAATACAAGCAAGAGTTCAAAGAAAGCGCCAGCTTCCCTCGCAAGTGTGTTC
AATCGGATCCCACTACAAAGTTAACTTTAGTTTCCAAAGGAAACGACATGAACAACGAAGCAACTACGATGAGTGCAACCGCTGACGCTGCTGCAGCAGC
GACGCAGCAGATTGTGGGTGCTGCCGGACCGACCCTGCAGACCACCAGCACGAGTCGAGCACTACGGCCAAGGACAACGGTCGGTACCTCAGCGGAACAA
GCGGGTCAAGCCAAGCCAACGCAGAGCAAGGGCAATAAACCCACGCGCAATGTAGGCGAAAGCATGACACGACGATCTGGAGCTCCACCAGCTCCCAACA
GGTCAAGCACTGGATCGATGTCGAGGACTGCGAACCTGGAACCGGACTACCCCACGGTGGCCCATCCGATCTTTGCGGTCACTGTGGCGCCGAAGGTGGA
AGATATCTCGCATGAAGCGCTTACCCAATGGGTGGATCTACGTCTGGAGTACGAAGAGATCATGAGGGCGCGCTGTGATTCGTCAGGAGAAGACTTGAAG
TCCGTCATGCGTTCTGTGAAGAATTCGTTCGACGACAGCTTCCTCGAGACGTTGTGTGAGACAAAATGGGAGAAGACAAAAGATGAACTTACCGATGCGT
TTATCTGGAACTGGGTCATGGATACAGAACGAAACTTCAGAAACAAAGCTCTACCAAACATTGACGAGTTGTTCCAAGACCAGTTAGTGATGTCAACAAC
CAAGTCGAATATCGATGCACGGGTTATAGACTACTTCCACCTGTGCAACACGATTGTGAAATCAATGGATTAGCTACTTTGTTCTCGACAGAGGAAGGTA
CTAAGAAGAAGTGCAAGGTACTATTGAATAGCCTGCCTGGAGAATTGAAGAATCGAGTGAAGAACGAGATTGACTTCAGATTTCCGGGTGCTAAGTCCAA
CGTGTCGGAGCTGTTCAAGATTGGGAGTGAGAAGGCCTTGGAGATAAACCGTAAAGTCAAAGCTTTGTCAAGAAACAAAGGGCGTTCTCAGGCGGTGGAA
TTGAAGCAATCAGCAACCACACGACCATCGAAAATAGCTAGACTCGATAAGCGAGTCGTTCGCGAACCTGGAACTCAGGTTGCACCGCGGATATTTCGGA
CCAAATCGGAGAAGAACCACCCCGGGCCGAAAGGAGGTTGCTGGACTTGTGGCGGCCAGCACCGGCAAGTCGAATGCCCCGAAAAGGCCGAAGACGACGC
TGCCGCTACCAGAAAGCCGAAAAAAGGGAGGCAACGTAAACCTAAGAAGGATTAGCGAGTGTTTACCTGGTCGAGCGGGACAAACCCGATTTCTACGTGT
CGGTGGCGTTGTCGATGTGGAATATTGTGCAGACCCTGGAGCCGAGACATCGTGTATCAGCTCCACGGCTTTAAAGAAAATTAAAGAACAAGGTGTGAAG
TGTGGAGGTTGAGCGGCGAGGAAACCCGATCGAGTGCAGACTGCCTGGAGACGATAAGGCGAGGTCTCGTGACCCCGACACCGAGAAGCAGCCGGTCAGG
AGAGAGAGAAGAGAACAGGGAAAGCCGGACAACTGTGTAGGGAAGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTTCGCTTTCTCTGCAGCTGCGACTTCCTTTCTCTTAAGCCACGTCAAC
ACTTTGTTGGCTGGCCCAATCAGCTTGGCGCGCAGGGTGTCGATCGCTCCTCTCTCTTCGTCGTCCGAGACGGCCATCTCGCTTGTTCGAAGCTTTCTTC
GATTGTTGATAATAACCTTAATGTCATCGAGCGAAGCCACCGGGGATACGTGTGCTTGTTGTTTGATAGTGTCACTCATGACAACGTCGCTGCAAGCGAA
AAGGACGAGGGTCAGAAGCAGGGCATGATTAACTCGTATCGCTGGCTAGCGGACTATTGTTCGACTTGGTGTGGGCTTGGGGGGGAATTGTCAAGTGAAG
GTAACCCCACGAGTCAAAAGCTTCAATTGCACCGAGTGAGTAGTACTCAGTGAGTACTACTCATTGAGTAAAGTACAGTATCAGTGATACTGCAGATTAG
AGTATCCCAACGTCAGTACTGTACTAGGTATCACCATCGCTCACAATCGTACAATGAGTATTACAGTGTACGTACAAGTTTGTAGACTCCGGGATCCGAT
ATTTTATTCCTGCCACCGGGTATAGCGGAAAGACTCGTTTTGTTTATAGTAAAATACACCTTACGCTTAATACGTGCGCTGTGCTTTTTGTTTTGTGGCC
TATGGTGTAAAACTGCGGTGCGTGTTACAGGAGATCGATGTTGATTTTGCTGAACAGAAAATCCTCTTTGTAGTGATACCGTCGGGGAGCCACTTTATCA
GAATCACAACCCAAAGCTGTACGTAGCATCGTTTTTTTTGTGCAATTGGACTCCTCTCATGGTTCCGCAACTTGAGAAGAAGCAAATGCGCTCCCAAAAC
TCTGCTTTCAAGACCTCACGTGTACGCCGGCAACTGGAGCGTCTATACCGCCGCGATTAATGGCAGTAGCAGCAGCAGCAGAAGCACATGCTCGAACTTA
TACAGTGAAGCTGACAATGGAGAGGAGGAACCTGATAGACAGTGATATCTACTTCCAGTCAACACGGAGAAGCACGTCATCAGACGAATCAACGGATCCA
GTAAGATCGTTTCCAGCTCGATTGCTTCCACACTGCCACGCGCAAAAAGTGCAAGTGCTGGAAGTACGAGGTCGAGTGTTTCTGGAGTTAGTACTGCAAG
AAGTAACAGTGCAAGCCCCATTCAAACACCGGTTATTGATCAACATGGTCATGCCAGGAAGTTTAATCGGCAGATGTAGCTCCTAAGAAGAAACAATCGT
CGCGAGGCAAGCAACTTGCCGCCGGTCTGAAGTATTTTTTTGTATTTTGTGATAGGCAAGTAAACTTCTGGATATGAAAATCGACAGTCGCTCGCCAATA
CGATGCTGTTGCAGGTTTTTGCTGTAGCTCCTGCATGTACCACGATACGTTGTAGCTGTTTTCAAAGGGGCTGCTAGTTTTGGCGCTCGTGTCGCGAAGG
GTCTGCGAACGGAAAGTTCCACCAACTATGGATAACTGTGATATCGTTCACTGGCTGCTTGCGCGGTTGAGCTTTACAGCTGCATCCCTGAGCTTGTCAA
AAAGTTGGTACTCATGAGATAGAGCGGGCTATCGCGGTCCAAAAACTTCCACTGATTCTGTTCCTTGTCGAGTCTTAGCCATTCCTTGACCTGGCCATGA
GTGATGCCTTCCTTCTGCAAATTCTTCACAGCGTCGTCGAGGTTTTCGGAGCGAGCTTGAGTTTTCACAAATTCCACAAGCTTCTTGGTCTTCGCTTTCT
CTGCAGCTGCGACTTCCTTTCTCTTAAGCCACGTCAACACTTTTTCAAATAGCTTACTCAGCTTAGTGCGCAGGGTGTCGATCGCTCCCCTCTCTTCGTT
GTCTGAGACGGCCATCTCGCTTGTTCGAAGCATTCTTCGACTGATAATATATGAATTAACGAGCGAAGCCATCGGGGATTCGGGTGCTCGCTGTTTGATA
GTGGAACCCAAGACAACGTCGCTGCAAGCGAGAAGGACGACGAGGGTCAGAAGCAGTACATGATTAACTCGCATCGTTGGCTAGCGGACTATTGTTCGAC
TTGGTGTCGGCTTGGGCGGGAATTGTCAAGTGAAGGTAATCCCACGAGTCAGAAGCGCCAGTTGCACTGAGTAGAAGTTTCGGATTAGATTCTTGCAAGA
TTGGAACGATGGTGATACTGACTGTACATCACTGGCGCTGTACAGACGAGTATTGTTTTACTTCGTGATTAATGACC