Description :
From Genome Similarity Track
Location :
Scaffold_99:90310- 91691
Transcript NameFunction/comments
Hyaar_Emoy2900105HaRxL121

Sequence
1381 bases(100 bases per row)
TGTGGCGCTTCTTGACATGCTTCGGGATCTTCGTCTGTCGCTTCACCTTCTTCTCCTCCTTAGTTTCCTGCTTTCGTGTCTTCTTGTTCACTTTATCAAG
CTCCTTTTGCTTCTCACGTTCCTCACGCTTTTGCTGCCGAAACTCGGCTCGCTGTTCGTCTGTTAGCGGAACCTTTTCACAAAGCGCTGATTTTTCGTCG
CTATCGTTTTCGCCATCATCGCTGTCGTCTTCATCGCTGACAATGTCACATTTGTTACCATCACTGTCGTCCGTACCATCGTCACTATCGTCATCATCAT
TGTCATCATCATCGCCGCTAGAATCAAGCCCTTGGTCATCTTCCTCGTTCAAAAGGTCCATGATACGCGTGCCTGGCATGGATGAAGCGGGTACACTTAC
TCGCTGGTCCACTTCGAGGCGCAAGATCGCCGTCACCAATGCTTTTTCCATCGTTCCTTGCTGGTACGCCAGCTGCTCTCGCTCCGAGTGCAGCACCTCG
CCCAGTGAGCGAGGAATAAACGTGCTCATAAACACAGCTTCGTCCACCTGCTCTTGATTCGTGCGTTCCTCAGGTCGATCGGCAATCATGCGCTGGATCT
CATCCAGACGGTCATCCACGTCCTTATCCGCAAGGCATGGGTCCGTGACAAAGTCAAACAGCTCCTGTGTCGTCATGGGATTCAGCGCGCCAGTCTTGCG
AAAGTAGTCGGCAATGTTGCGACAATCTTTGCGCAGAAAGTCATTGGCACTCGGATGCTCGTGCTCGACTGACTGCGAGACGTCAATAAAGTAGAGCTTT
GTCTGGTAATACAGAATGTTATACTCGCTCAAGTCTCCGTGCACCAAGCGGCACTTCTGATACATCGTGCGCATCATCTTGATGCAGTAGATATAACACT
CTCGGTATCGGTTGTCACTGATCTTAGCATCTTTCAGACGTGGAGCTGCCCATCCATCGCGACCGATAAAGTCCATAAGAAGCACGTGAGAGCGCAGCAA
AATAGGCGCCGGACAGTAGATCCCAGCATCACGCAGACGCCGCAAATTGCGCATTTCTTTCTCCGCCCACAACTTGACCATCTTGCGAGGATTACTCTTC
GAGTAGCCATGACGAAAGCGGAACTCGCCCGAGACGTACTTTTCCCGGTCTTTAAAGACCAGAATGGACGTCTTGTAGACTTTAATAGCCCCTTCACGAC
CGTCCGGGAGGCGTGCGTGGTACACATTTGCCTCTTTGCCCGTACTCAAACAGCCATTGATCTCCGTCACAATGCGGTGGTTCAACATCTTGTACAGGAT
CATGCGCGTCCGTGGGTCCAGCACTTGCTCCGTCGTGGCGCGGTCGTCTCGGCCCGTGTGGCGCGTGCGGCCGCTCTCTTC