Description :
From Genome Similarity Track
Location :
Scaffold_233:9031- 11327
Transcript NameFunction/comments
Physo_144667hypothetical protein

Sequence
2296 bases(100 bases per row)
TTTGAAGGGACGGCTAGCTCAGTGGGCGGCGCTGTTCTCCCCCCATTCGCTAGAGATCGAACGTTTAACGAAAGGCGAAGATGAGCTACTAGGTTTGGTT
GCCGCCAGTATCACTCCGCGCGCAGAGATGGATGCAGCGTTGGAGGAGATCTCTCCGCAGAAGAAGTCGACGAGAGCATTGGCTATCCCGATGCCGACTT
TTACGCCCGGAGAAAACGTTTGCGTCGTCAGCTTTGACGGATCGGCCAAGCCGAAACGAGTTGGTGGAGCTTTTAGCGCTGTGGTATGGGATGCTCCTGG
ATGGAAGGTTGTCAAGGCTGAATCTGGCTATTTACCGGACCTCACTGTGAACGAGGCCGAGTACCATGGCCTCCTTCTCGGACTTCGTTTGATTGCCGAT
CTCCAGATCGACCGTCTCATTGTGTGTGGCGACTCCAATTTAGTCATCCGCCAACTGCGTGAAGAGATGGAGTGCAAGTCATCGGGATTCCAGCTCTTGC
GTGAGAAGGCCAGAGTGATTTTGCGGTCTTGGCCGCAATGCGAACTCATCCACGTAAAACGCGATTGGAACCAACCCGCGGATATGCTGGCGGGACAGGC
GCTGCAGCGTGGTGCCGGAGTAGTTGTCGAGAGTCACACCGATTACACGGACCTCGAGACTTTGAATCGACTGGACGAGCTCGTCAAGATGCGCCAAGAA
CGTGACGCCCATCCGAAGGTAGGCGCTGTCACGCGAAGCCGATCTCGTACTGTCGCACCAGCCGTGTTGCAGGAAGACGTCGTCAAGCAGCTGCGCTTGG
AACGTATTTGCCGTGCTCAAGACGAGGAGGTGTGGATCTGGTCACTGAAGTGTTTCCTGCACGGTGATCCCTCTCAGATCTCGAGCCGTCAAGCCAAGAC
GTGCAGTAAACTGGCTGACAGTTACGAGGTCGACGAGCATGGCCTCTTGATGTACTGTCTAGTCGAGGGGCGCGATGGTGATGTCGAGGACCGTGGATCT
ATGGTGAAACTGGTAATGCCGAGTACACTCCACGAAGATCTCCTGCATCATTTCCACACAAGTGTGGAGGGAGGTCATCAGGGAGTCAGCCGAACATTCC
AAAAGCTTCGGAGGCATTTCTACTGGCGAGGTATGTTCCGAAGTGTGCAGAAGTATGTCGAGGAGTGTGTCGACTGCGAGACGGGAAAAGGAAAACCCAC
CTTGCGGGGGCGATCGCCGGGCAATATCGCCGCTAATTACCCTTTCCAGGTCGTGGCTATGGATCATATCCCCACCCTCCCGAAGTCGTTCAAGGGCACA
CAGAGCTCCTAGTCTTCGTGGATCTCTTCACCGGCTTCGTTGTGGCAAAGGCAAACGCGGACAGGACCGCACCAACAGTGGCTGAGGCATACGAGGAATG
CGTGTTTCGGCGGTACGGAGCCAGCGAAGTAATCAGGCACGACCAGGAACCGAGCTTCGTGTCCGACTTTTTCCGGTCGTTTAATGCGCTGCTGGGCCAG
CGTCAGTGATCTACGCTCGCGTATAGACCTCAAGCAAACGGCACAGCGGAGCGGATGGTCCAGACTATTTCCAGATCTCTGCGGATGTACGTTGAAGACG
AGAACCAACAGGACTGGGGCTGTTGGAGGGACCGGAAGCCGAGATCTCGACCCACAGAAATGGAGGTTCAAGATCCAACGCCAATACCAACGTGCTCAGA
CAGAGACTCGTCGTCTCTTCGCCGAAGCTCGTGAGAGTCGCGCGGAAGACCACAATGAGAACGTACCGGAGTCACCCATTAAGGAGGGACGCAGGTGTGG
CTGTACCTCGACCGAGTCAAGGTCGGATACGCTCGGAACCTCGCTCACATGTGGCATGGGCCTTTCAGAGTCGCCACCATGGTGAGCGACTACGCTGCCA
AGCTGGAAATCAGCGGGACTGACTACCGACTGTTCCCTATCGTACACATCTCGAAGCTGAAGCTGGTCCGACAGTTCCCCGAACGACCCGCCGAAGATCT
CACTGTTGATGAAAGCGAACGATTTGACTTTGACGAAGAACTTCTCCCCGAGGATAGCTGGGAGGCACAAACTCGCGGTGACAACGAGTATGAAGTTGAA
GAGATCTTGGATGTCAAGACGGAGAGACGCACCCGCTACGGTCGACGGCTCAAGGAATATTTGGTGCGTTGGAAGGGCCACGCAGAGACGAATTGGGTCA
AGGAAGAACACCTGAACTGTGGTGGTCTGCTGTTCGACTACCAGCAGAAGCGACGGAGCCGGCAGAGGTTCCATGTGATGCAATCGCGTGGAGAGG