Description :
From Genome Similarity Track
Location :
Scaffold_30:90307- 106586
Transcript NameFunction/comments
Physo_134114predicted protein
Physo_134115hypothetical protein
Physo_134116hypothetical protein
Physo_156834hypothetical protein
Physo_15683560S ribosomal protein L7A (RPL7aB)
Physo_134119hypothetical protein

Sequence
16279 bases(100 bases per row)
CTTTTGATGTGCTTGCTCCTTGTTCTTTCAGAATGCACCGTCGGCGCAGCCGATGTACAACCATTCGCACCAGGGCAACGCGGCGTATGGATTTGCAGGC
CAGTCGCAGCAAACGCGCCACGCGCGCCGGTTGTATGTCGGCGGCATCGGAGAAATCTCGGAGCCCGAGATCACCGCGTTCTTTAACGATGTCATTGACC
GGGCACTTGGAGAGAAGCAGGAAGGTGGTTCTGTGGTGTCCGTCTACATCAACCGCGAGCGCCACTTCGCTTTTGTGGAGCTGCGCACCATTGAGCTCAC
GACCGCGTGCATGAACCTCGATGGAGTGTCGTACAACGGCCAGCCCCTGAAGATCCGCCGACCTAACGATTACAACCCCGCCACTGTCCCCAAGGACCTC
GGCCCGATTCCGCAGCTCAACCTGGCAGCGCTCGGTATTGTGTCGACCACTGTGAGCGACGGCCCGGGTAAGATCTTCATCGGCGGTCTCCCGTACCACC
TTAATGAAGAGCAGGTGAAGGAGTTGCTGCAAGCGTTCGGTCCGCTGCGTTCGTTCCACCTCGTCAAAGAGCTCAGCTCCAACCTTTCCAAGGGCTACGG
GTTCTGCGAGTACATGGATATCAACGTGACGGACGCCGCGTGCCTCGGATTGAACGACATGCGCCTTGGTGACAAAACGCTTACTGTTCGCCGCGCAATG
TCCCAAGAGAACGCCAAGGCTGTCGCAAGTGCAGCAGGTACGGTGAACACAGGCCTGGAAATGGGATTGGACCCGTCGCGCGCCGCAATGCAGGCTATGA
GTTTGGCAGGCATTCCCAGCCTGCCACTCGGTACGCCTTCCCGTGTGATTGTGCTACTCAACATGGTTACTCCGGAGGAGCTCGAGGATGAGGAAGAGTA
TGCCGACATTTTAGATGACATCAAGGGTGAGTGCGAGCGCTTTGGTGCTGTGCCGTCACTGTTGCTGCCGCGTCCCCGAGACGGAATCCCCAGCGCCGTC
GGTAAGGTCTTTGTTGAGTTTGGCGATGTGCAGTCAGCCCAGAGCGCGGCGACAGAGCTGCACGGCCGTGGATTCTCAAACAGGACAGTGGCAGTCGAGT
TCATGGATGAGGGAAAGTATGCGCGCAGGGAGCTTGCGTAGGTTTGCTGAATCGCTAATTTGGCAACTTTATGCTGCTGAGATAAGAGTAGCGGGACTGA
TGCCCATACTCCTATGGACATCAAATGGATGCATTGCGTGGGGCAACCAGTCTTCCGACGACACTCGGGGATTAGCGTACGTGCTCGATGTAACTGCTCT
GTGCTATGTGCTTCTCACTGGTACTTCCTTCATATCATTCATAATAAATGCGTGTGGTTTCTCTTCCTTTTCGTGTCTTCAGTAGCAGAATATTTACACA
CACACGATTCCACCTCGTGCACCCCGGGGGCTCTTTCGCTTGAGCTTCACGTAGCTTCATCGAGCACGAACTGCTGAGCCAAGGAGTAGCCAAGGTCCGT
GGCCTGCAACCAAAACCAAACGTTCACGGGTCATTCAGACGACGCTCTCCGGTTCAAGGCAATATCGTCTGTGAGAAGCGCACCTTGCGGAAGTGCGCTT
GTGCAGCGTCTGCATTTCGTGGGACGCCTTTGCCATGCGACAACAGACACCCTAAGTTGAAATGTGCATGCGGGCTGTTGAGATCTGCGGCGCGGCGGTA
GCATTCAGCAGCTTTCAGGAAATTTAAGTCGCATCCTTCACCTTCTTCGTACATCAACCCTGTCCAGATGAAACAAAACCAACGGTGTTAAAGAGCTATG
GTGGCACAGAGGAGCGGTTGTTGTACCTAAAGCGTTCAAGGCTTCGGGATCACCAGTGTTTGCCGCGATGCTGTAAAAGCGATGTGCCTTCGATTTATCT
GGCGTGCAGCCAATACCCGAGTAGTACATGGTGGCGACACGCTTCGCTGCCTTAGCATGGGGCTGATTGGACATCACATTGGGCGGTGAAGGTCAGAAGT
TTATCGACGTGAAACACCTCAAGCATCCGTACCGTAGTTGCCGTGGCAGCTTTGGAATAGAAGCGAAGGGCAGCGCCTTGATCTCGAAGAAGCGAAGATG
TCTCCAGCAATTTACCGAGGGCGTAGTAAGCGTCTGTGTGCCCTCCGTTCCCAGCGCTTAGCAGCAAGCGAAGTGCTTCATCATGGGACTCTTCCCGATC
TCGAAATTGAGCTGAAGATGATGTTGAAGTCAAGGCCGCTGCTACATCGCTCGTCTGAGGTGTATCGAGAAGCAGCAAGCTTGCGAGGCGTGTCATGGCT
ACGCTGCTACCTGCATCTGCAGCCTGAGATGCGGAGAAGTGAGTCTAATGGAGCTCTGAGTCAGTCAAAGGAGAACGTACACTTTGGAGAAATGCAATCC
CGCGCTCCATGTCCTGCTTGACACCGTTGCCCGTGGTATATAGCAAGCCGAGTCGTGTTTGTGCGCTCGAGTCACTCTGTTCGGGACACAAGAGATTCGG
TTACCTCCCATTATCAGACTACGATACAAATGCAATTTCTCACCTTGACTGCTGCGCGCTGAAGGAAATGAACAGCTTTGACCACATCTTGCTGAACATG
CGTTCCCACAAGAAAGAGACGTCCGAGACTCGCCTCGGCTCCCGTATGACCCTGGTCAGCAGCTTTGGCGTACCAAGTGGCTGCTTCCATGTCATTTGGT
TCGCATCCACCGCGTCCGTGTTCATAAAACATCCCTGGAAACCAATCGTGAAACTAGTGAGGTGCCGAAGAGACCCGTTGAATTGCCTGGATGGTTCGAA
CCTAGCTCGAATTGAGCGTCTCGGTGACCTTGCTCCGCAGCTTGGGAAAAGCGAACTCGAGCAAGGGCGAGAAATTCATCCGATTGTCGTGCGTCTTTCG
AGTGTGCAGCTTTTTCGCACTAGACAACAAATATGGCAATGCAAGGACGTTAGAGATGAGCTTGAGACAATTTATGGCAAGTATGGCCCCTACCTACCAT
TAGCAGACCCAGTTGATGACAAGCCTCGAGATCCCCAACAGAGGACGCAAGCTCATACCATTTTCCTGCCACGAGCAGGTCTTTCTCCGTTCCATTTCCA
GCGAAGTACATTTGTCCCAAGCAAGTCATTGCCACGGCGCAACCAAGGTCCGCAGCTTGCTGTCATCGATACGCAAACGCACAGGGGTGAGAGATCTGAG
AGGTGAAGACGAGATAAAAAAAGTTGTGCGTATTACCGCGTATAGCATGAGTGCTTTTTGGAGATTCTTGGCGACGCCGTGGCCGAAGAAGTACTGATGC
GCTTCCAAGCAGATTTCATCCCCAGTAGGAGCGGGTATTTCTGCTGGTTCTGGTGGAGGTGGTGGCGTCACAGGGGCTGGTAGCGGCAGCTCGATACCTG
ATCGACGCGCGACTGCCATGGACAGCTCCATGAATAGAGATGTGTAATACGAGTTGATCTCCTGAAAGGCGAACAACACCTCGCGCTTGAATGTCCGATT
GAGCAAGAATTTTGCGGCGCGCAGACGCTCAGCAATTGCAGATACCTGTGCCAATGATGCTGAAAAGTTCTGTAGTGCGACAGAAACACCTTCATTCGAA
GCGTGCTCCACGAACTCGGCCTCGTACGCCGCGAACTCATCTTGTGCTTTGCCTAGCAAGCCTCGAAGCTCCCCACCCAGTCGTACTGCAAGCAGCTTGC
GCGGGTCCACGCTGTCCAGCTGAGCCAAAAGTTTCTCCAATATTTCTCTAACGTCGTCCACCAAGGGGTGTGCTTCGGTTGCTAAGCTCGCGCCACTCTC
AGGGTCGACAGACGCCGACGAGTGCCTTGATTCAGACTCCACCTCCTTGTTTTGTTGTCCACTTGGCTGTTGCCTTACTGCACGACTATCATCCGACGCT
TGTGATTTTTGAAGCGATGATTGCAGCAGCTCTGGTTTGCTGGCTTGTGCTCGCTTAACTATTCCGAACATGGTGCGCATACTGGAATTGCCTTCCCCAG
CCGAGCTCACGGGGCTTTTGACACTGCTAGCAGACTGCTTCTTGGAGCGAGTAGCGTTCGATGCATTTACCACATTCTTGGCGACAGCAAAAAGCAGTTT
GGGCTCGCGAGTCTTTGTATTTGACGTAACTTCAGTTTTCTTGGTGTCCTCCTGGCTCGTCACATTTTCATTTGCAGGTCCTGTCGGCGACATTGCAGCA
GGTGTTAAACCAGGCAACGGCGACGTCACGACAGTGCTTGGATCACTTGCCATGGTCGCTACAGCGCCACCCAAACTGCAATGGAGAGCGAGGTACAAAG
TGCACAAATGTTCAAGGTAACGCGACCAGCTCCCGTAATAGAAGAGAGTTTAATTTTACCGCTAACACGCATCAGTCTAGCGCACAAGTGCGAGGGTCAA
GCTCTGCAATCCCCTAGTCGTACTGCTCCCAGGCTTGCCTCCTGCTACTATAATACCCCTAATCTCCCCATGTCTGGACGAAAAGTGCGTCTCAAACCGA
GTTATCTTCTTCTCTCGGCAGGATTGATTCAAACTTGCACCTTCGCCAAACTGAAAAAAAGAATGGGTGGTCCACGACATCCTCTACGGCTGGTAGTCCG
ACGCGTATCTGCGGGACGTGCGGTCGTCGTGTCCGTTGGACGGCATGGGGCGTCGATACCCACGCTCCATAGCTTCGTCCTCCCTGCGCATGGGGCGTGC
GTCATTGCGTCGGTAGTCATCGTCCCTCGGTCCGCGCGCAGAGTATCCACGGTCTTCGTAGCGGTCTCCGCCGCGTCGGTAGTCTCCACGGTAGTCCCGA
CGGTCACGAGAGCGAGAACGGGAGCGAGAACGACCGCGGGGCGGGCCACGACGGTACGAGTCTTCACGGCGTCGGTCCGCCCCATACTCAAAGCCACGGT
AGTCCCTGTCCCGGTCGCGTCCATTGCCATTGCGGTCTCTCGAGCGCGAGCGCGGTCGCTCCTGGGGCGGCGGGGGGCCTCTGAAGTCGCCGCCATTGCG
TCCGTTGCCACGGTCACGAGAGCGGGAGCGCCGCTTGCCGCCCGAAGGCTCGCCCATGCCGTTGTTCATCGGCGGCGGGCCGCGCGGGGCTGGCTCGGGC
GCGTCGTCGAACTGTCCGTTGCGCGCCGGGGGAGGAGGAGGCGGCGGAGGTCCCTCGCCAGCAGACGGAGGCGCGGAGCCCGGGGCGGGCGACGCGTTGA
GGCCCGCCTTGGTCATCCACGCGGGCAGCGTGTTCGCTCGGCCTCGACCGCGTCCAGCCATCGTTCGCGTAGCTGCTGGCTTTTGAATTAGTTTGATGCT
CTGGAAATGAACTGACTGACGTGCACTTAGCGAGTCGGTCTAGTCCACTCCTTTTTATAGTCCCATTTGCGATTTGTGACCGCCAAGCTGTTCAAAAAGC
CATTGGCCGTCTGCAGTCAAAGACTACTGTAGACCATGTCGGGTGCCGGACGGAAGAGCGCGTACCGCAAGGGCGTGACTTCGCGCGTGCTGTATGGAGA
CCCGGAGCCCAAGGAGAACGAGCTCATCGTGCGCGTCACGGCGCTGCGTGGCAGCAACCTGTTCGAGGTGCGCGCGTTTTGTGCACTTGACTTTTTTGGT
CCGGTGGTGCTGGTGTTGACCTTTTTTGAATTGTTTCGTGCTTTGCGGCTGCAGGTGGTTGACGCGGAAGGCGCCAAGTCCGTGACCATGCTGCCGACCA
AATTCCGCAAGCTTATTTGGGTCAAGAGAGGTAAATATCATCGCTTTTCGGCACTAAAATGCTCGATTCGGGAGCTTTCTTGGCTCTGGAATTATAAAAC
TGCACGCTAAACGGCGCAATACCAATGCGTGCAGCAGCCTGGACACTTTTTTGTTGTTGAACTTAATTGTGATGTCTGTTGTTGGTGTTGGTAGGCGACT
TTTTGATCGTTGGAGAAGGCGATGGCGGTGAGGCTACGACGGCCAAGGGCAAGAAGGGCGCTGTGACGTCCATTGTCGAGCACATTCTGTACAAGGATCA
AATCAAGAATCTCAAGCGCAAAGACCTTTGGTATGTTGCCATGGCGTTCTTAAGGTTTTGTTCAGGGTGGTGAATATCTGAATGCTGACATTGGTTTCGA
TTATTTTTTAGGCCTGCGGCGTTTGACGATTCCTCTGCGAGTACGGCTTGGACTCAAGGTGATGTCGATGAAGACGACGAGAAGAACGATGACGAAGATG
CCGAGGAAGAAGATGCGGCTACAGCTTCGTCCTCGAAAGGATTGACGATGGTGGCAGACAGGTTTGCCCAGATGAAAGTGAACCGGAATCGCCGCAAGGG
TCACTTCGACGACGACGAAGAGGAGGAGGACAGCGATGACGAGTAAGGCGTGCACTGAAAGGCGCTGCTTACGACATGCGTGTCCTAGACGTGTTTGGCC
AAATTTGGCAGCTTCCATATCGATCCATTTTTCAATAGAGTTATTGTTAGGCCGAGATGGATTTCGTCCCTTGAGCACTGCAGACGAGCTGTTGCAGAAA
CAGCAGCAGAATCGACCATCATGCAGCGCAAGCGCAGCAACGTGTACAGTGCTGGGCCCTCCGTGCTGGTAGGTTAGTCAGACTGAAGGATTGTGCAGGA
AAACTTACACAAAGACCTTGAAGCAACATCGGCACTCCCTCTATGCCACGAACAATGACCTTGAGAATCCTGACCCTCAACTCGGTGTTTTTGGCAACGT
ACGTTGGCTTGATATGTGCTGGTGTTGCCTATCGTATACTTACTCAAACTCTCGTTGACGAAAGTATTCCGAGAAAGACTTTTTCTCCGACCTTCGTGTC
GAGATTGATCGCGACAAGCATGCAGTTTATCCGGGGTACCTTCGAGGCAAAGCATCTATTATGCGATCTTCTGGAATCACCACCAAAGTGATAACCAGGG
GGAAAGCAACTTCTAACGGTCCAGAGTCTTCCGTGTTGGTACCGTCAAGTATCCGCCAAATGCAAAGGTCAGTGCGCAAGGAAAAAACATTTACTTCGTA
CGTTTGAATGAAGCGCCTAAACGCACATGGACTTTGGTGCAGACGGTGCCAGTCAGCTTCTGCTGTCCGAAAGAAACTTTTTCACGCTGTAGAGCAAGGA
TCGAATACTGGACACCAGCATCCGAACCACAAGTTACAGTCCCAAATGGATGCACTGCGGAACCTGGCTTCGGGGTCGCTGTCTAAGGCGCCTACGAAAA
CGCAAAAAGGGCATCGCACACCCAGCGCTGACGCGTCGATTTGCCACGGAATCGTGAACCTGTCGCGGAAAAATTCGGGGGCGTCCATGGCAACGTGCAA
GGCACAAAACCAAGAAGAGTGTATCTCAGGAGTTCGGATCGGTCCTAGCCGTTCAGCTAGTGCTTCCATTCTCATGGCCACGTCCACCCAGCCGTACCAA
CCACAATCGGTTCTGGTAGGTGGGTACAGATCGTCGTCTGTGCAGCTTGAAGTCGAGCTAGTGGAGCGGTTAAACGAAATCGGGCGCTCAAATGTACGTA
TACTCGCAAAAATACGTTTGAATGGTCAAGGAAAACTAATAGCGATCAACGATCAACTGCCTCGCAGCTACCTGAGAAAACCTTGTCACGTACGAGAGCG
TGCCAGGCTGTACTGGACAGCATCGTGCTGCAGGATGAGGTGTGCTTTCCAGTTTCAGACTTTAGTCGTAAGGATAGTATAACTCATATCCTCTTCGTGC
TTTACAGCACTATGGGCGACTCCTCTCAAGAATTCGAGACGAATTCAGCACGTACGTCGACATGACATGCAGACGGAGTCCCGCCAAGCCTAGTAACTCG
AACGGGACAAAATCATGGTGTGCTTGTGGGCAAGACATTTTCGGTAAGTGTTTCGAAGCTCCCCGTATCTAAAATTTCACTGTCTAATAACCATGACTTC
CTACAGAATTCGCGCTATTGAAGCAAGAAAATACAGTAATGAAAAAGCGAGTAAGCAATATGCAGCACGAGATCGAAAACTTGCAGGCGGCCTTAAGGCA
AGCAAGGACTGGCGACTCGAGCGGGCGTAGCTACGAAAGTGTACGCGACACTAGTAGCACTGGCACCTGGGCGGAGGATGACCAAACACAAGAAGGTAAG
ACCCCGGTCAATCTTTGTTTTGTCATCCAGCATTGTAGTAGTGACACATGCGATCTCTACTTCCCTTAGACGATCTTGACGATGTCCAGCTTTTTCCCGC
TGAAGAAGTCCATGAACAGCATTTTCGGCCACTGGGCGTTCCGAAGCTTAGCTTTGCTGCTCTTCCTTTATACAGCGACGAGGTAAGCTTAGGAGAACTT
TTGACAGCAGCACATGCAGGCTCTAACACAAGAAATCTTTTGACTTTTCCTAGGAGGAAGACGAGGAAAGCCAAGAGGAAGAAGGATACACGCAATAGTA
GAGCTACTTAGCTTGCGGAGTTTATGGTTGTGCAGTTCCTCAGTTGCAAACATCATCATCATACTTTGAATTCAGACATTCTTGGCAAAGTGTTGTTATC
TGGATGCACATATCAATCCTCCGTTTTACCAAGTCTAGTCAAAAGCTCCTTCAACAGCTCCTGCTGCTGACGCTGCTGGATAAGAGACTCCCTAGTCAGC
GATTGCATCTGGTCCATCGCGGCACAAACCCGATACATCGTGTAGATAAACACCAGCGCACAGATTATAATGGCAGCTTGAAGAGTTGGATGGAGCTGGG
TCGGGGGGAGGCCATTACTTGTCGCAGTTGGAGCTGGCTGCACCAGTGAGGCTGGTGGAGAAACAGTAGTCGCAGTAACTGGTTGAGGCGAGTCCTTTGA
CGTCTTCTCCTCGCACGGGGACGGCTTCGTCGAAGGTGCACTCGCAGGAACAAGAGTATCAGATCCAGTTTCTGCTGCGGGTTGTTGCTTTGTTGCTTCG
GCTGCAGCGTTTAGCCATGATTTCACGGCGTCCTTGGCTTCTGACACAGTTGTGCTTTCGATCTAGGAGGGAGGGGACGGAAGTCAGTCTCAAGTCTACA
ACAAACCTTTGTCTGTGGAGTTTAATCACCACAAGCGTACCTGTTTTTTCAGCCACGTGCTCTTCGACCATTGAATGCGAAGACCCACCTGCACCAAGCA
AGCACCTTGATTTTTCGTAGCACTGAAGACCCATCGATGCTCGACCCGGAAGTAATCGCAATATGGTACGTCCGACACGCAGGTTGTAGTGCTCACGACG
AGGCGACTGCCGGGCGTATACGCGTATCGTTGGGTTTGAGCCGTCGGAATGACACTGGGACCTACCATGTACTTCTTGTTGTGGGTGTATGTGACTAGCC
GAGAGCCATCAAACGAGTCTGGCTTGCTCACTGCCGTGTATGATACAGTTGTCTTTTTCCACGGAGGCATCGATAGGTTCGTCGACCCGGCTGTATCAAG
AATACTGCGGGCGAATGCGTCTGACTCGACCCATAGTTTTGAGTAAGCAGTATCGACACTACAAACAACGCATGTTAGTAATTCCGTGCAAACCAATGAG
AATAGCGTGCCTTTCATACCTGAATGCGACTTCTTCATCCAGCATCAAGTCAAACTCGCTTAGTAAAGCGTCTTTCTCTGGGATCACAGGGGGTGCTCGC
ACTGCTGCAATTTCCGACGCAAGAGAGCTTGGAGGGCGACTATCCTCGGCAGGTATCGTGTCCGTTGCCGCGCTTGGAGTCATTTCGGGGCTAGGAGCAA
CGGCAGCCACCTCATCCGAACTTCTTCGTCGTCTTGAATCCCCGTCCGGTGGAGAACTACCATCAGTATCAACTGAAGCTGCTTCGGGCTGTTTGGCTGG
ATCTGACATCAACGCTTCCGTTTCTTTCTTTATGGACCGTAGCTGCTGAATACTTTGAAAGCATTCATCTCTGTACATTGTATGCATGGGCAGAAATTAG
TTGTGCCAAGAACATGAGAGTATATGGTGCCAAGTGATGCTTACCGAAACACAAATGAAGTAAAGAAAACTTTCTCCCCTTTGACTGTGAACTGCAAATC
AGTATCACGAAGTGAGTGGTGATGACACACAGGACAAAAACTTTAATCCGTTCTTACCTCGATAGCGTTGGGAACGATCAGTGCTGTGTTTTTCTTTTCC
ATGAGCGAGATCTCCGAGAATGAAGCCACCTACAGCATGGACACCATTAGAAGATACATCACCAACAGCAGCATCATACTCGCTTGGCACGGTGTAGCTT
ACGAATATCGTATCTCTCCATCCGGAAAAACACATTCGGTCTCTAGTCAGGTAAAGACGTCCGTGGAACGGGAAATTGGAGAGGTAAAGCGCACACGAAA
AGCTTTCCACGACCTGCTCCGGCGAATCCAGCTATTCATCAAAAGAGCAACACGACAAACCCATTAGTTTGCATAGGTATTCTCACTTCCACGGGGATTA
GTTACCTTAAACTTCTTCTGAAAGTCGGATACTCCGAGTGGCTGAGCTTCAGTGAATTCTTCATCTTGCTCCATTCCCGAGCCTGCACTTTCGTCTTCGA
TTGGAGAACTCTCGCCCTCAGCAATGTTGTCATTTGCTGGTACTGCCTGGTCATCCCTCGCCGATATAACGCTTGAATTCCGAGACAAACGCGGGGATTT
TTCCGGGGAAGTTACGAACTCGCCACTTGAAATTGACCCAGGTGGATAGCTGCCACTTGTAGGACTTCGGGGGTTCTTGTCCGAATATTCTGAGGATGCT
CCAAGTGACGAGAGATATTCGCGCATCACCTCTTTCAAGCTTTCGTTACCGTGGTACGCGGGTGCGATACGCTTGCTTCGTTCATACGGTTGCCTGTTGC
TTCGGATAAACTCAGCAATGTCTCCATTGGGATCGATTTTTTCAAACTCGATCAGTGCCTTGTTTCCAACCGACGTGCCACCCTGCAGCATATGCTCGAT
GGCTTTTGCCAGCGATTGAAGAGAATTTTTGCCAACCTGGAGTCGGTACTTCTCGTTTTTCATGTAAGTCGAAATGAAAACCTCGATTTCCTGTATTGCA
GCAACAACGGAGTAAGTAGTCGTCGTAAAAAACCTGCATATTCCGAAAGGGACAAACCTGGACGTAGATCTGGTACGTTTGTCTCAAAGACTTGCTGCTT
TCTGAGACTTGTACTTGGAGCAGACGGATCTCTTCCGCAAGCTGACGAAGTTTGGCTTCCGACCGTCGATCCTTTTCGTTGAATAAACGCAAATTTGCAC
TCAACACTTTGAGAGCTTGTGCAACCTCGATCCCGTAAGAATTGGTGGCAACAGGCGTTGATCCTGGCATGTACGAGAATGTCACTGCAAAATCACGGGA
CTTCGTATCCAGTTTATGCTGAAGCTTCTGGTGTGCAGCTGCTTCGTTGCATAACGTGGAATGTGCCTTCAAGAAGTTTTCCTGCGTCGAGACTCGGACA
CTTTCATATTCAGTCTTCATGGTGGCGAGACTCAAAGACACGGGCTCGGCAAGCAATGATTGAAATTCCTGAGTACAGTAGAAAGCATTCGTTAAGCATG
ATACCCACAGAAACGCTTGTATATAGCGACATACCTGATGAACTTCCAATAAAAGTTTGACTTGGTCTTTCACAGTCAGCCAACCGTTCGCCATTGTTGC
TCCTTCGTCGGCCAGGAAACTAAGGTTCACATTGGACGAAGACGTGCCAAAGAGATCCGATGGAGGAGTGAGGCCGCCACTCTCGTGCGTTCGAAGCAGC
TTCCGCAGGGCCTGCGAAAAGCGGGCCTCACTCGCTATAAACTCGGTCACGACAGAATTGATCACTCCGATCATACGCTGACCATTGTCTGACATAGCTT
GAATATGCGTCATACGTAGATAGAAAGGATTGATCGACAAGTCTGCCCGGTCCACATCCACTTCCTCCTGGCTTCCAAGACTTTGAAACCCTTTCTCAAT
ATCCGCTACAAAACAGACATACAGCAGCGTTTAGCTTACAGAACGATCAGCACAACGTCGAATCGGTAAGATGATGCCTTACCTAGCTCGTCGACTTTGC
TTACACTCTCTTTCATCCGCTTGACGAACTGTTGCGATCGAGAAAACATGGCGACGAACGCTTTTTGCATGCGCATCAGGACATCTCGGAGGTATTCGAG
CCGTTGTTCTTCCGTAAGCTGGAACGCGTGCAAGTTTTCTTTGATCTCTCGCTCGATAATCAAGCGTTGTGCGTTGGTGTACTCCACCGTCTGGACGTAG
TGCTTCTCCGCGGCAATGACCTCTTCGAGGCAGCCGTACAATTTAGATCGTTGCCTCTCCAACGGATTACGCCCAAACGAGGATGTAGTATCCCACATCT
TCGTCAGCAGTTGCCCAGCACCGGCTGCGAGTTTATCTGTCAATTCCTTGGACGACGACACGTCATCGGAGGACTCGGATGACGACGAGTTGACATCTGA
CGCTGTGCTGTTATCACTCTTTTTCATCGTCGTAGTGATCTCAATAGCCTCTTGGCACTTGCGCTCGTACTTCTCTCGTGCTTTTTCCATCGACGAAATC
ATTTGCTGTTGCGCCCAGCGCACCTTGGTGCCCTCTGCAGAGATCATTTACAACAACCACCTACGTTTAAGTCCTTACAACGCCCCAAACAACATGCCTG
AAGCGTACAAAACTCCTGACAGATATCCCCACGAACCTGTGATGAGTCGTTGCACCTGAGTCTCCTGCTGGGCCGCAAAAGCCTTTGCTCCGGGGACAAC
AGCAGTCTGCATCGTTGACGCAAATGCCCATCGCTCCTGAGCCAAATGATCGGTCGCCTCCTGGAACGTTGCCCAGCACTCCGTGAGCTGCTCAGACCAG
TCCTCAGCCCTTGCACTTCTGCAAAAATGCATCCGACGTGAGTAAAATCACAAGACCTCTAAATAGTTCCAGCCTAGCTGCACCGTACTGGGCCAGTTTG
AGCAGCGACTGAGCGTAGTTGCTCTCCAAGGCCGCGCGTTCCATCACAAAAGCCGACACTGCTTGGCAGAGCTGCACGCCGCTCTTGGCCTTCTGGCTAA
CTTTGGGAAAGGCTCGAAAGAGGTCCGTGGAGTAGGTTCCCTCCGTCGGTGCCGCGCGGGGGGACGTCACCGAGCCGTCATCGCTGCGGGCGGTGGGGCT
GCTGTTGCCCCGTGTGGGAGACCCCTTGGAGGCAGCTGTAGCGTTTCTGGGGCTGCTCTGGGGCCTGCTGTCGGTTCCAACATCCGGCAGCGTCTCCACC
TGGAGATCCGCTGAGTCCTCTGTAAGCACAACGCGCGGTACATGAGGCGAGAGAATCGCGTAGGCATGAAGACGAGTTAGTAGGCGCTAGATAAGGGGGA
GAAGGAGACGGCAGGACGCACCCATGGCGATGCGAGCGGAGACAGCTGCTTGAGCACGGCTTGAACTATTCCGCACTGAAACGATAAAGGTCGGACGAAA
ATGGAAATCAACACTTAACTGATATGATTGCAGTTGAAGGCATACAAATTGCAAGTCAGTCCAAGGCGTTAGGTACCGAGGCTATGCTATGCAGGTGAAG
CCCACGATAGGATTCATCGGGGGATAGACCAAGTCAAAGGCGAGCAGCAAGGAATCCTACGGGCATCAGCAACTTGTGAACACGAACCCTGAGCATCAAC
ACGTTCTCCGGCCAAGCACCAAGTAACATAGCAATTCAGAAGGGTAAAACTGCAAGGATAGGATGAACCAAGAGGGATGTTTTGGATGTTTGAATGTTAT
TCAGCCATTACAAATTGCCAGGAAGGTGTTTCCTCCTGTCGAGAGCACCTAAAACGGGGCGACGCGCCACACGCCACACTCCGCTTCGAACCGGTACACA
ACTTAGTACTGGGCCTTCTTGGCAGCCTCGGCAGCGATCGCCTTCTCACGCAGCTCCAGCTTCTTCTGGGTCTTCAGGCCCATGATGCCACCGCCCCACT
TGCGACGCGACACGGCATCGTCGTTGAACTTGGCCTTGAAGGCCTCCGAGAGCGAGTCGAACTTGGCCTTGTCCTCCTTGTTCACGTGGGTGAGCGCCAC
GACGGCGGCGTTCTTCTGGTGCACGAGCTGTCCCAGACGAGCCTTGCCCTTGACGATGCAGTACGGGATGTCGAACTGACGGCACAGAGCGGGCAGGAAC
ACCACGAGCTCAATGGGGTCCACGTCGTGGGCAATGACCACGAGCTTGGCCTTCTTGTTCTCGATCAGCGAGGTCACGTGGTTGAGACCGAACTTCACGA
CGGCGGGCGGGGCCGAGGCCTCCTCCTTGCCGGCGGCGATGTTGCGCAGACGCAGGGTCTTGGCGGCCTTGGTCTCCGGCTGGTACTTCAGCAGCAGCTT
GAAGAGGTCCGTGGCTACGTTCTTCTCCAGGGTGTTGGAGAACTGGTTGATCGACGGCGGCACCTTAAGGCGCTGGTAGAGGATCTTGCGCTGACGCTGC
AGGCGCACGTAACGCGGCCAGCGGACGAAGCGGGACAGGTCACGCTTGGGCTACAGAGATTGAATAGAAGACAGTGCAAACGTCAGTATTTCCGTGTCAT
GGGCATGTAGACTGGGTGGGGCTCCACCACGCCAGAAAACAAGTGAGCTGGTGCATGACAACGCGGCAGAAAGCGAGGTTCTTTACCCTTGAGGCGCAAA
TCATCGCGAGCGAATGAAATTGCCACCACAAGTTTGTGTCATTGCGGTCGTGGTGGACCCGCTACACTGTTCTCTAGTAAGGGCCAGGGCAGATGAGAGA
GGGAGTCAACCTGAACGGGTTGTCTCTCCATCTGCCTGGTCCTCACCGAGGGGCGTGGAATCGCTGCCGAGAAGGCGAAGCGATGGCATGGAACTCTCTG
GAGGGACACGGCGCTTCAAAGTACCTGGATGTCACCGCCCTTGCGGAAGTTCTTGGGCGTCGACACGAAGAGGGGGTTCTTCTTCGAGGCGGTCGACGCG
GCCTTGACCGTCTTGGTCGAGGTGACCTTGGTGGTGGTGGTGGTGCGCTTGACCTTCTTGGTGGGCATGGTGATCGTAGATGGCGAATAAACGAATGGGG
GAGCCTCGCGTTCGGCGGCGCCTCTGAGCCGCCCCCAACAGCCAGTCATTCAATATTTCGTCTTTTCAACCAATGGCAACGGGGGTGATAACCAATGTGG
GCCACGTAATTCAGAAAGTGACATGTCAGTGAAATGAAACTTATAGTTGAAGTGGTGCAGCGAGTTGAAGTGGCAGAGGCTGCAGGAAGATGGCCCCAAG
TCGGTATCTTGGACAACAGACGCAATCCTTGTAATGCAATGCAATCATTTACGTGCTCGTGTAGATACAATACTTGTGGGACAAACAAAGCGCGAGCTGT
ATTTGAGCTTCGCGAAGGGCTGACTTTCCACCTCCACCTCGATACCTCGATATCGCACTTCGAGCGTTGCTTGACATTCCATTGACGACAGCTTTTGCGA
GTAGGAGTTGAATTCAGCTGGCATTGTCATGCTAATACGGGCAGGCCACCAGGGCTCGCAAACGGTGCTGACCGGGTACCCGTACCCGCCCGTGTAGCCG
TCCAAGCCGAAGTCGGGTACCCGTACCCGCCCGCCCACAAGCCACGGGCCAGCCAGGGCTCAAGGTTTTGTACGGACGGACCAACTGTTACATCTCCCGA
CACGGTTTTAAAGTTAAACATTTAAGTAGGAACTACGCGAAATCAATACAGAGTGAAAAGGACTTGTGGAGGCTAAAAGAAGACGGCGTAGGAGCATGAC
ATAGCTGGTATAAGTAAGAAATATTACTATTTAGTACTATTTTCGTCAACTTCGGGTACCCGTGGCACCGCCCGAGGTTTGCTTCGGGTACCCGTACCCG
ACCCGAAACCGGGTATACCCGAGGCGGGTAGGGCGGGTACAAGAAACGGGTACCCGATTGCGAGCTGCAGGCACACGAGCAGGGTGGCTACAGTAGCGCA
CTTACGCGGACAAATACGCATGGATCCGGTCATACACGTCAGCACCGCGACGAAGGACCTCGCTCTTCCACGTGCCGCTCTGATGCAGATAAAACACATC
CCGAAGTTTTTGAGCGTACGGCAATCGGCTCACGGGTGATGGGCTGTGGTGATACATGGCGTTTTCCTCGATCATCGCTTTGAGGATGAACACCCCCGGC
ACCGTCCCGAATTCCTGGCAGAAGAGAAGCGCGTTTCGTTTAGTCTGCGGTCCAAGCAAACTCGCTACACCGTCAAAAGTGAATCCGCCAACGCCATCAT
ACCCACGCGACACTGGGTTGTCGTTGTCGTGCACGAAGACTACCTTGTCCGTGTACTCTGGACCCGTGAAGACATCGCG