Description :
From Genome Similarity Track
Location :
Scaffold_252:903- 3643
Transcript NameFunction/comments
Aphin_H310_14836Hypothetical protein

Sequence
2740 bases(100 bases per row)
CTCAACATGCTCTGCTGCAGACAAAAAGTTGCCACGCGTGGCCAACATCGACAAGAGCAACCAGTCGTTCTTGAACGCCCTGACGTTGCAATCGCAAAAG
CAAAAGATCTACGAGCAAGCGTTCGTGCGGTACCCTGAGTGCAGGAGCACAGTGTTTGCGCCAAGTAGCTGGGACCCGCGCAACATATCTGTCCAACAGC
TCGAGCTGCCGAATATGCAACTCAAGCTGACGCGAGTGCATGGGTACCACAGCACATCCAACTCGAATGTGTTTTACTTGGCATCGGGGGAGCTGGCCTG
GTTCACGGCCAAAGTTGTCGTCATGTACTCCAAGTCGAGGCAGCTTCAGCGGTTCTACATGGGCCACTCCAAGGAAGTGACTGCAATGGCGATGCACCCA
AACGCGCAAATCGTTGCGTCGGGGCAGTGCGGCAAGGACTCTGCGCTGATCCTTGTGTGGGACAGCAAGCGAGTGAACGCGGAACCGACTCATGCATTGG
CAAAGCTCGAGGGACAATCCGTCAACATTCGAAGTTTGAGTTTCTCACACGATGGAAAGTTGATCGCGTCGTTGGGAGGCGACTTGTACAATACCATTTG
CGTGCACGACTGGCAGGACCAGACGCTTCTGGTAAAGGCCAGGTGAGTGCGTTCAAAAACGAGCCTAGACAGCTCAAGGCCTGGAGAGTTGTAGGGGCCA
CAGCTCCAAGGTTTGGACCGTGGCATTCAATCCGTACCAGGCGTACGGAATGCCCGACAAAACCAAAGCGCAGCAGCGGGTGCCCAAGAGGCAAAAGTGG
GAGGCGCGGCCCCGCCCTGGCCAGGCTCTTCGAGATGAAGATGCGTGCTACACTCTTGTATGTCCACGTCGTCGCAGGCTGCATTTTAAACGTGTCGTAG
GTCAGCTGCGGCGTTCAGCACATCAAGTTCTGGACGCTGACCCAAGTGGACTATTCGCCTCCGACTACTGTGGCCAAGGTGGGGTGAACATAGATTATTC
ATCTCAGCCCGGCCTGAAGGAGGAGAGCGCATTCTATGGGTCGTGCTTTGGCGGGCCGAACCGCGCTAGGCAGCCCCTGCCCCACGAGAAAGTGTGGAAA
CTAGAAGGCAACCCTCCGCTGATGAAGAGCGAGGCCCAAGACTTCACGTGTCTTGCATTCACCGACGATAACGTTCCTCTGCAAGTGTACGACGAAGCCA
CCGACTGTATAGTCGAGTCCCCGACGGTAACAAGTTTGCCAAGCCCTACGGAGCATTCATCACCCCCCTCACAGCAAAGCGAAACCACGCTGGGTCGCAT
TGTCGCCGGTACTGCCAAGGGCGACCTGTACGTATTCTGGCAACCTCGGAGGTCTCCAAGCCCGCAACAACCTGACTTGCCTCAGAAGTGGTGGGAGCTC
CCTGCTGCGTCGTGGCAGCTGAGCGACGACGTATGTCTCGAGCATGTCCACTTCGAATCGACAGCGAAGCTCGTGGAAATTATCCCGCACGACGTATCGA
CTGGAAACCGGTTCAAAATCTCTCGCCATGCTCAAATGGAGTTGCAAGACCTCCAACAAAGGTGATTTGTACACGGATGAGGTCGTGGCTGTGACCTGGA
GACGTAGACTGGCACTAAAACCTGATGCCAAGCCGTTGCTCGATCGTCTCGCCAGCCTGGAATACAAAGGCCCCCTGGCTCACGTGAACGGACCGTGCAG
CCAAATCGCGTGCGATGTCAGATCGGGCAATATTGCGACTGCTGGTGGTGACGGCAAGGTGCACATTTGGACTCTGCACCTCTTGGACCCGATGAGAGTA
TGTGGGACTCGAACGCTGGGCCAGTACACCCCCATGCATGGCGCAGCCAGCGACGGGCGACACAAGATGCAGCTCGAGCGAAGTATTCAAATTCCGTCCA
AGGCTCGGCTGACAAGTCTCCACTGGAGTGGCGATGGAGCGGTCGTGGCTGGTCTGAGCAACCACAGCATTTGGGAAGTGGATGTTGCGACGGGTGAATG
GAGTGTGGTGGTCGAAGGGTGCGAGGGCAGCGTGTTAGGTACGTCATGGAGAGTGCACGGGGAAGACTCAACTCGATCGACGAACAGGGGGGGTGCTTTT
GGAGGACCAGAACGAGCTCGTGACGGTGTCAAGCGATCACTTCATCCGGTGCTGGGACATGGGCAGCCTCCTGTGCGTGAAGAAGTGGCCACTTAAGAGC
ACAGGTACATACATCGAAGCCCATCCAAGTCGCGGCGACCTTGCCGTGGGGTGCGCAGGGGGAGAGGTACGGCGCACTCTTCACCCTTCAAGGCACATGG
GTTGTTGCCGTAGGTGGTAGTGCTCAGCTACCCCGAACTCTCGGAGAAGAAGGCGCTTCGAGTGCTGAGCAACGAGAGCGTAAGTGTGCTCAAGTTTAGC
CCCGACGGCAAGTACTTGGCCGTGGGTGCCAAGGACAACTGTATGCACGTCTACGATGCGACCGAGAGCTACAAGAAGGTGGCCAAGTGCGAGGGACACG
CCACGTTCGTATCGCACATCGACTGGAGCATCGACGGGTACTTGCTGCAGACCAACTCGGCCGACGGCGAGATCTTGTACTGGCAAGTCCACGGCGCGTC
CGTCCGCCAGATTACTGACGGCATGCTGGTACGTGTTGGTTCTGCAACGAGAGCAGCTGACGCAAGTTGCAGATGCGCGATATTTTGTGGGACCGGTGGA
GTTGCGTGTTTGGATGGCCTGTGCAAGGTATTTGGGCAGA