Description :
From Genome Similarity Track
Location :
Scaffold_2135:903- 2028
Sequence
1125 bases(100 bases per row)
GACCACAATCTCAACTGTCTCCGGTAAATTACACGCATCGCGGAACTGAGCGTTGTGCCTGGTATGACCGAACCAATTCCGGCATTTCCTCACGAAGCGG
CCTACAGCGTCCGGCGAATTGCCGCGATGGATAGCGCGAAACATCTACTTCCACAGCTCCGCGTTGGCGCGGGGGTATAACCTCCGTGGTACATGACTAG
GTTGCCTCCTTCAACGATGGCATCGGCGTACAGCTCATCGAGTATTGTAGCTTGGTCACTTCCTCGACAGAAAGCACTGCAGTGCTTGCGAGATTCtcga
cggtggtggtgctgacaCGCCCTTGGCTAGCAGAGGGGCTATCGGGTCCGCGAGGCCGTGCTTGAGAGGGACTTGCGGGGCTTGAGGTAAATGTGAGAAT
GAATTGTTTCTTAGGAGAGCGGCCGCGTCCTATCCTGCACTCGTGCTTCTAGAACTAGCTTCATATTACCGTCTCTTCCTCTTTCTGTTGTTGTCACTCC
TTCAGCTCTCAGTCTTTCAGACTTCTCTGACGAACTGAAGCCAGACATTTGTGGGTTGCTCTCAGTCGTGTCAGTGCGGATGAATAGTTTTATTTCGCAC
CAGGATTTTAATGAGGACGAAGGGCTAAACCTCCAATACAACTTTATTTTTGGGTGACACCGAGATGGAAGATGTACCACGTAATGGAATTTGTTTACAA
ACAAATAATCTTGCTGTCCGCAGTGTCTACCGACTTTCCGGCGCCATCAAGCTTGCGACAGAGGTGATCGGGAAATGCTTCCGTTTCTTGAGGTTTGTGG
AGGAATCCACCGGAATCAAAACTGCATGCATGCATTTGTAAATACCCCGCTCAATTCGGAACTCGCATGTATTTTAATATTATACATGAATACCCGTACA
GACTTTTAGGACACCTATAGAAGTCACACTGACCAAGCAGGCCCATTCGAGTCGGATCCACTTCAATTTGAAGCCCACCTCGATGGTCATCAAAGCAGTG
TGTTCATACCAGCCCTGCCTATCGTACATCAATTTGAAGCCCACCTCGAGGGTCATCAAAGCAGTGTGTTCATGTCAGTCCTGCCTATCGTATGTTACTC
CAGGGCGTAGAACGAACAGGACGGG