Description :
From Genome Similarity Track
Location :
contig_43:90280- 92109
Transcript NameFunction/comments
g6325.t1hypothetical protein

Sequence
1829 bases(100 bases per row)
CATACCAGAGCAACGCAGCTGGTCCACAACGTAACCATGGTCGAAAACGCCAGGCGACATCGTCGGGTTCGGCTTAATACACCGAATAAAGTTGCAGCGC
GTTGCATTTAGCGTGTCCGTCAGCTCCTGCATCTGATCGCAGAACTTGGCCGACACGCTCTGCTTGTGAAGCTGACTCAAGTTGGACGCGCCATTCATCG
AGTCCAGGTCCAGCTTCGACGAGAACACTCCTTAATAAGCGAGGACTTGCTAGACGTCACGAAATCTTCCAGGTCCTTGGGAATCGTATCGTTGTTCTTG
TCGATGAAGTTGCCAATCGTGTACGGCACACGCGTGGCGAAGTGCTTGACGATGAACTCGTACTTCTTGTCCTTCTCGTGAGGAGGCAGGAAGTGAGAGT
GACCCGCGTGCGTCTTGTGCAGCGTGGCATTCCACTTCTCGTCGGACGGCTTAGGCATCTTCGCTTCCTGGTCCAGCAGCGGCAGAATACCATTCGGCTT
CTGCGAAATTAAGTCGATACAGTCGCGGTTATCGGGCCACACGATCTTGCCGACCTCAATACCTTCAGCAGCGAACAGCTCCTGCTCGGCAATAAACACC
TGCTGGTTGAATGTGGCCTGCAGGGCCTCGTTAGCGTAGTTAATCAGCAGCTGCTCAAAGTCGTTCTCCTCGAAGGACTCGAAACGAAGATATCGAGCAC
AACCGATGAACGGCAGCGAGCTATCACCGTGGCCAAGCGACGTGTTGATTCTGTACAGAATCCACTTGAACAGGTGGTAGATGGACTTGGCGATAGCGTC
ACGCACGTAGCTTCCCTCCTTCGCCGTGCGTTTGATCGTAAAGTTCCCGTACGCGTCGAGATCTCGCGCGTCGTGATCACATGCAGCAGGTTGGTGCTAT
CCACACGAGCAGCTCCGCGCACGACGCCACGTACTTCTGCGCCTCCGGAGTCACCTCGCCAGCGTCGCCCTCCGCCGTTCGCGGTCTTTCAGGCGAATGT
TACCAAGATGCAGAAGACCGGACAGGATCGTCCAAACCTGCTTCTGCAGCGCCGCGTCAATGTTCACAGATCCAGAGCGCTCGCCACCTCGTCGAACAGG
ATCTCATCGTCCACATTCGGGTCGACACCAGCCGCTCTGGTTCAGGTAGTCGAAGTTGTTCACCGACTCGAGCTTGAGCTCCTTCGTCAGCGCCTGGTCC
GCGCCGGACAGCAAAAAGTAGAAGATGTGGAAGTTTCGCTCGCCTGGGATTTGCGCCACCACGCGGAACTTCTCGAGCAGTAAGTCTCAATGAACGCGCC
AGAGAGCGTGTTGTCCGCTGGCTTGAACTGCAGCTTCATGAACTTGCCGAAGCGCGACGAGTTGTGGTTGCGCAGCGTCTTGGCATTACCGAAAGCTTCG
AGGATGGGGTTCGTGTCCCAGAGCCGCTTGTCCAGCTCCAGCGCCAGGTTCCTGCTGGGCGTCGTTGCCCTTATTGGCCGTGAAGGCCAGGTGTTCCCGG
GACGTGAGGTACCGCAGCACGATCTTGGACGTCTCGGTCTTACCGGCTCCGGATTCGCCCGAGATGACGATCGACTGGCACTGCGCGGGCGTGCGCAGCG
CCATCTGCTGGAAGGCCACCTCAGCGATCGAGTACGGGTGCGGGGGCGGTCCCCCATCTGCGTCTTGATGTAGTCCGTGATTGGGCTCCACCGTGCGCAC
GAGCGGGTTCACGGCGATGAGCACGTTGGCCATGAGCGTGTAGGGCCTCAGATTGTCGGCCTTGGAGCGCACGAACAGGTTTCGAGGATGCCGGCCTCGT
GGATGTAGTACAGACTCGTCATGTCGTCA