Description :
From Genome Similarity Track
Location :
scaffold_15:902689- 903807
Transcript NameFunction/comments
Plaha_PHALS_00855p-type atpase (p-atpase) superfamily

Sequence
1118 bases(100 bases per row)
CAATAGCGCACTTGCATAGCCAATGTTGACAGCAGTTTCCATTTTATCGCCTGTGAGAGTCCACAACTTAATATTTGTCTCTTGTAGCAACCGCAGCGTC
GTGGGAACCCCAGCCTGAAGTTTATCTTGAACTGCAGTAATTCCAAGCAGCACAAGATCGCCTTCAATTTCGTTTATTAACGGGTCGATTGCATTCGCAC
GACCATGACGTCGCTTGTCCACATCTTCCATCGAAGCATGTGCCTCCATAAAACGAGCGTTCCATTTCTCGTATTCATGTCGAGCAATACTTTTATAAGC
CAGGCATAAGGTGCGCATTCCAGCCTTTGCATACAACGAGAGCTGATTCGACGCTTGCTCGCAGGACATACCACCAAACTTTGTCGCTTGATCCATCGCA
AGCCGCTCAAAAATAACATCATCCGCGCCTTTGCACAGCAATTCAATTTTCCCGTCCGGAGTCTCTACAATCACACTCATGCGCTTTCGGTCACTTTCAA
ACTCGATCACATTCAGCAACTTGTATGTGCAAGGTGTTATCCAACCTGGCTCCATGAGCATCATCGCAGTGGACGTTCTGTGTACGAAACGGACATTGCA
AAACGCAGCTGCAGACACAAGCGCTTGCTCGTCAGGTGATGATGCAGAATACTCCGGAAATGACGTACTGCACATCTCAGCAAGCGATTTAGCAGGTATC
AATGTATGGCAGAGAGCTAAGTGCCGTAAGAAATGACGAAGCATTTTCGCCTGCTCCCCTCCCGCGAGAATGTCGGCAAAGAGCTCAGTCGGGTCAAAAT
CTACAAATCGTGGGCCTTTCGCTAATCCAGCCTGCTCAATTTCCTTAGAAAGTTTAGGCTTTAATTCAGTTTCCTGAATGGGACCGCCATAATGCTTTCG
TCCTACCATTAAATACCGAAAAAGCATAAGATTCATTGTGAGAGTGCCAGTCTTGTCTGTAAAAATATGATGCACACGGCCAAGATCTTCGTTTAAAGCG
GAGGATCGGACGATGGCCGGTGCGTCCAATTGCTTATCGTACATTTCCAGATCTTGTTCGATGAAGTAGGCTTGCCAGTATTTTACAAACTCTAGCGACA
CATTGAGCGAGATGGGAA