Description :
From Genome Similarity Track
Location :
Scaffold_57:9026- 10504
Transcript NameFunction/comments
Phyag_g1315hypothetical protein

Sequence
1478 bases(100 bases per row)
CACCACTACTAGCGTGGAGTCACTTAGCTCGGGTTGATTCTGACATGCATCTTGATGTGGCCGCCTTGCGTTGATCGTGGAACCCACATCAACAGCGATC
CTCCGCCGGTACCAGGCAAACCGAATAGACCAGGGCGCCAGCGGTCCAGATACATCGTCCTGTCTTCTAGCTCTGGGATGGTACAATTCCACGATACTGT
atcgccagcgccaacgtccACCTTCGCGTATTCATCACCACCTGAATGAACGACCACCGTTACATCTTTTGTGTCGGTGCTTTCGAAGATGAGAttgacg
acgccgtcgccTGACTTGGTCCAAGTGCCGTACGTGCCTGTGAAAGCGTCGTCTACGGTTTTGAGGCCCAAAGCTTCGTAAAGAGTTCCATCGTCGATCT
CGCCAATGAAAGAAGTGGGGCCACAGGTGGGCTGGATGAATTGAGAAGCCAAGTACGCGAGTCCCGTGGGGTCGAATGTTGACAGCACGCTGAGACCCAT
GTCAGCAATGTGCAGCATGTAGTCATTTGACGATACTGACTTGCCCATATCCGTTTTCCCTGTTTCTACGAGCTGGTCGATGATCACACCGAACGTTTTA
CGGATCAAGTCGCGCGTCTCAAAGGCGGCTTCTTGGGTTTTGTTGTGCAGCAGTTCTCCCATGCAATTGTTGGTGACTCGGGGAATGTCGTACAGTACAA
GCGGCGACTTGCTCACAGTTACTCGAATAtcatcgacagcagcgtTGGTCTTATTGCGGAGATCGCTGACAGTAGAAACAACGCGGTCGGTGAGACGTTT
GAGCTCCCACCCGCACGTCGTGTTGGAGTCCATGAGATCCTTCAAGTCCTCCACGCTACTTTCTGCAGTGTCAGCTGTGACGTTGTGCGTAAGGAAGTTC
ATGAACGTATGTGCATCCGACGTGATTTCGTCGCCGTTTGTGACGACCTCTTTCACGATATTTTCCACGACAGTAATTACTGCACTGGCATAATTCGCCC
CAGCCGGGACTGGAATTCCAAGGCAAGCGCACACAGCCACAGGCAGATCGACCAGAACTGCGTCTGACTGATATGCTGCATCGAGCAAGGCCTGATCGGT
GGTCGGTCCGGTGTCTTGAATAAGGGTCAGGTATCTCAAAAGAGCCTTGATCACCTTGATCATATTGGTGGCGCAGTTGATAACCAACGCAACCTTCTTG
AAAGTGGTCAAAATCTCGCCAAACACACCGTCGGTGGCAACATTGAGCGCCACAGCGATCACTGCAAAGATTTTCTTGAGAGTATCAGTCAAGCAGTCGC
CATTTTGAGGTAGGCATTCACTGCCGCATGGTACGGGATACGCCATGGGACAATAGGTTATGCAGTCATCGCCATCTTTGCCATAGCCGAGTGGGCAGAT
GTTGTGGCTGTCGAAGTCTTCGGTCTTTCGATAGCAGGCCTTGTCGGTGGGGTCACTGATGGTGGGTCCTACCCAGTT