Description :
From Genome Similarity Track
Location :
contig_15:902437- 913798
Transcript NameFunction/comments
g4373.t1hypothetical protein
g4374.t1XP_002907583.1 DEAD/DEAH box RNA helicase, putative [Phytophthora infestans T30-4

Sequence
11361 bases(100 bases per row)
ACGGTCGTACACACCAAAGGACGTTGGCAAAGGATCGCGGACACCCACGTGCCATTGCCACCAAGAAATGCTACAAGAAAGCTTAGGTGGTGGCGGGGAG
TCCGCTGCTAGCGCGAAGAAAGCGTTGACACAAGCCCAGAAATTGGTGCACCTTGCTTCAGTCAGACCCAATGCGCTGACGCTGCGTGAATATCGCGAAG
GACTGGAGGTTAGTTGATGAGGAGGGGTCGGTGACTCGAATTATCATCCTAATCACTTGCGGTATTGTGTTTAGGAATGCCTGAAGCCGGAAGGCAGTAC
GGTGATGAAGGTTCTGGGATTTCAACTGGCTGGTACTGCTCCGGGTTGCTCGACCAACGAGATCTGGAAGTTTGTGTTGGAGGCAATCGTCACGGAGCTT
GGTAACTCCGAGAATCCGTCAGCCTTAGCCGCTGCAGTTCCTGTGCTTGGGCTCATTCCAGTGCCTCTTGTGCTGGGCTTTTTGCTTTCTCCTGAACGGG
AGCCCATGAACAAGCTGCGAACAATACTGACGCACGAAGACGTCGAGACACGCTGTCGCTCGATCGAGATGCTATCCAAGCTAACGCTAGATATCGCCAT
CAGTGTTACTGGTGATGGTTTGTTCGTCTTTCCATTCGAGTCGCACGAAGCGCGAATTTGCTGCCAGCAAGACGTCGAGACCATGGTAATCGACTGCTGG
AAACTGATTTTCCACACCCTTTCTTTCGATGAACAGTCCCAGACTGCGGCGTGGGCTGCCGGCACTGCGTTTACAGCCTTGACAAATCTATTTGCTCGAT
GCAGTACGATGACAGCGTTTTTTTCAAGCACTCGAGAATCTACCCGAGCGCAAGCTCCTATAGACGACGTTGCCTCTGTGATGTACAAGCACGCATTTCC
TCGAATTCGAGCGTTGGTTGTTGTTGCGCGCGCTCTTCCCATGAAACAACAACCGGATGCCATGCTCTGGATCTCTATGCTGCTTTACACTATGATGGAG
CGTAGTGGTGCGAGATGCCCTAGCATCAGCGTACCTTACGTTGAGATTGATGCTGATAACAACAATGTCGATGGTGCCGATGAAGACGATGATGAATCTC
ACGCGTCTACCGAGCCTGTTCGAGTGGATGAACTGGTGAGTGATTTGCTCGAGTCCTGGGCATTTCCTACGATATCGAGAAGAGTATCTCTGGCGCAAGC
GTCCAGCATGTGCCGCGCCATTTTTATTCTGCTGGCGCACCCTCTTCAAACACTCACCCGCATGCGATGGGGTGCGCAACTGACCAACCATCTCATTGCC
CAGTGCTACCTTGCGAATAAGAGCTCAAGCAGCACCAACGGAGTTGACGTTAAACGTGAGCTATGTGTGATGCTCGTGAAAACATTTGCGTGGCTGTCCG
GAGTCAACTGCCAATCACTCTTCGTGCGTACAACTGAAGCTATCTACCTCGTCGACCAGGACAAAGACCGCCGTGATCTTGTGCAGTCCCTAATGGACAC
GATCGCTGCACACATTGTGGCTAATCGAGATTTTCAACTGCTCCAGGGGTTGTGCACGATGACTTTCTTCAGACAACCCAGGGGCTTCTCCAGATTGTCA
CCACGTACCAATGGCTCAGAGGTGTTTCGAGCACTTTTTCAATCTCTCTCCAACACAGCAGACCTACCACCTCGGCGCGGGGCCATTGAGCATCAGGTGT
CCCAGCTGATTGCCTTGAGGGTCTTCAGAGGGCTTTTACTATTGAAACTTGGCGGGTCGGCCACGACTTCGCCCAAGGCCTATCGACGGTCCTGCGAGAT
CAGCGAGAACATCGTTTACTACACGGGCTTGCTGACATCGCACTTCCAGGGCATGCTTGCATGTCCCGAGCTCACCCTTCGTGAGTCGCTCGACTTTTTC
CAGCACGAGCTATTCCCGACAATGGACCAAATCGCATCACAAAGTGCTCGTCTTCAGATACTTTGGATTGGAGTGCGTCTTCACCGCAATTACGCGGCGC
ACGTACCTTTTGAAGTTCTGGTTCGAGAGCTACAGCACGAGACTGGTCGCCTTTTCACTGCTATCTGGAACGATGACGACGAAATGGAGGGAGCGACTTT
CGACAATGGATTGCTGGGATGCGGTGGCACTGGCGAGGACACACCTGCGAACCGTAAACGTGCGGGAGATGCTAACACTGTCGACACATTGATGGTGCTT
GGTGACTGCATTACACTGCTGGCACAATTCCAGCCCAACACGCAGCCCCAGTTTATCCAGATGTGCGAGAAAATGATCGCTGCGCTATCGGCTTCAGGAA
GTTCACCGGCAGCAACATCTCAGCAGTATCGAATGTACGTAGACCAAACCGAATTATTCCTTGCCATCGACAAGCTTTACTAATCATGACCACATTTGCA
GCATTGAGGACGTTGTAGCTCTCCTTTCGACTCCTTCGACAACGGATCTTGCACCTGAAGACCCGTATTCGACAGAGATTTTTGACCCGCAAGACATTTT
CCTGCCACGAAAGCATTTTGACGAGCATGGCGACACGACTAACCCGGAACTTCCTCAGGATGAAGAAATCGGGAGCCGGTCACTGTCACGGGTAGTGCTG
ACCCCGTCTCCATTCGGATTTCTCATCACCACCCGTTAGCAGGAAAGGAAGAAGTGATCTCTCTCGAGGTCAGCTGCTGCAACCTCACTACATGGCCCCT
GAGCGACCTGGAAATTCAGCTTCATCCGCTCGGAGGTGGGGGCGTTGTTCAATGTGTGGACAAGTCCAAGGAATTAAAACTGCGTTTGCTACGTACCGGT
GAGACTGCGAGCGTTGGTACAAGCGGAGGCAGTACCAGCTTGCCGCCGTTTGGCGTGATCAAAGCGGAAAAAAAGTTCCGTGTGTGCAAATTCACTCAGC
CCAGCTTTCTGGTGCAAGCGGTCTTGGTCCGAGAACCTAGTCAAGACGGTGAAGATATTGGTGGCAATCCTGCAGAGGAGGCGTTCGCTACTCCAATTCG
TTTGGCCTTTAGTAGCCCCTATGTGGTTCACTTCGACACACTCCTTCGACTGCCCCAGTCCCAGTTTGCTACCGCTGCGTACTTCCAACATTGCTGGCAA
AGGTACGACTTGACTGCAACTCTTTTTATTGCTCAAAGGTTCCTCAGTCGCCTATCGTTCACGTCTGCGTTCTAGTTCCAACGCGAGCGTTCTGTGGCCC
ATCAGCGCACAGACCTCACAGGAAGTCGAACTAAGTGTTTGCCAACACACGCTCCACTACATGCATGCTAAAGTTGCAGCGGCTCCCGAGTTGCAGCTCG
AGCTACCCATGCACTTTCACGTACGTTCTCCGCGTCATTCTAAACTGTTTCCAACCCCCGTACTCATCTCTCGTAATTTGTAGATTGCCATGCTCACTCA
GACGAGATGGGGCTCCTATGTGGTGGCATCATTGACCATGAGCCTAGACTCGAATTCTCATCTTCTGCTTGGTCGGGCGCTGGAAGTCCGGTCGACTTGT
GAAAACATCCGCGAATTTGAGAAGTGGCCGAAGGACGCAGTTCGTCTCTTTGCTGGGGAGATCGTGCAGCTCTGCAGTAGACCGGCATCCGCACTTTCTA
CTGCTTGTGAGAGTGCAAACTCGTCCGATCAGGCCAGCAATGCTGTCAGTGCAACGCCCTCCCTTCCAAACCCACCACCTCTGATCTCCAACGCGTTGCC
AGCTGCAGCCCCGGCCCCAATGCAGGTTGCAAACGGAATGCCGTTCACCGCGGCAGACCCCGTACTGCCCACCGCCTTCGCACCGGACGTGCGGTCCACC
ACGAGTTTCCACAAAGACGTGGGTGCTCCCAGTGACCGAAAGACCTCATTCACTCGCTCCGAGCAAGTCCGAGCGCCAGAAACATCCGCACAAGGCGATC
AGTGGGGGACCTTCCTCTGAAGTTGAAGGCAGCTTCAACTTGATGTAGCACAACACCAAATTCGCCGGTCGGAAGATCATCAACCCGCTTTTTCATTGGC
TAAAACTCGTATTAAATCACTTTTTCTCGCATCAAATCCAAGATGCGGCCTTCGGAGCACCAGCGCGGTACTGCCGGTGCGTATCGAGGGAGCGAACACG
CGAGCGAGGAACGCGTATACCGCCCGCTGCTGTTCCAGTCCACGGGTTATGCGTCTTCGGAGCTCTTCCGCGACTCGTATGAGATGCACTCGCGCCTGCC
GACCGCGCCTCTATTAGGAGTAGAGACTAGTGCCGCCGAACCAGAAGAGAATCAGAAAAAGCGTCATGTGTTCGAGCCACAGATCCGACTCGAGACGCTA
TCGTCGCGGGCTGCTACAGCAGTGCTTTGGGTCACGTATTTGGTGTTTTTGCTTGCGATGGCACTGCCGTATTTGCAGAGCAAAGGGTACCTGGAAACGG
TGAGGACTATTTTTTAGGACTATTTCTGATTCTTGAAGACTTTTGTGACGCTTTTTGTGATTTTCAACATAGGCGGTGGAACTGCCGGGAGGGGTTTGCC
AGACAGAGAAAAAAGTGGGAGAAGAGCCGTGCATTCAAGTGGACAAGACGAGGAGTATTGCTCAATGGACAGCGTACGTGACGAATGTGTCGCGGTACTC
TGGTTCCATTGAGATAAAGCTGGACGTTCGGGAGCAGGTGAACGCTTCAACCTCGGTGGCTTCACTTGTGGAGAGCAACACGTATCAGGAGCTGGAACGT
GTGGGCACAGCGTGGAAAATGGATCGAAAAGCAAACAGAGGAAATAGTAATTTAGAGAACGAAGCCTCGAGCATTTCGGAGGTTGCGGAAGGGGAGGTTG
ACCAAGAGGCAGGATATGTATTGACCTATGACGCCAGGCTGTATGGTATTGATCACGAGGTGACCCCTGCTACGAAGGATCTTGTAACAGATGAACGGAA
TCAGAGTATTTGGATCGAGTGCCGATCTAGCGAACCGTGTGAAGTTGTTCAACTACTGGAGATTACGCAAGACGTTGATCGACTGGTGAGAACACTAAGG
GAGATGAATCGGATATTATTTGTGTGATTGACCTTTTGGTTGTATGATATCTTTAGGGTGGAAGCGGATACGACGCGTATTTTGTCATCGTGTCTTTTAG
AGGGCTGTATCCAAACGTCTTCGGCAAGGATGTGGTTTATCAATTCGCGTACACGTACGTACAAATTGTTGTTGCTGAAGTGAGTTACGCTTATTCGGTG
AGCACTAACTTGCTAAATTATGTTATCCAGTAAGCCAGCTATTCACGTTGGCGAAGTTATTGTGCGTGGAGTAATGGTGTTAGCATCCATTTTGGCGCTC
CCTTGCTGGTTCATTTCAGTTCTGAATTTCCACGGTGGATCATGGAGCCAAGTGCTTACCGTACAAAAGTGGTTACTGGGAATTGGCGTCGTGCTCGTAC
TCTGGCAGAACCCAGTGTACGCAGTGTCTCAACTGTACACAACCGTGAGCATGCGCACGCGATTTGTGTCGATCACTAGTCAATCACTTGCGGAGGCTTC
TTTCTACGTGTTCTGGCTGAGTCTCATGGACCTACACAGCGGTGATTTCACGTCTCGAAGATGCGCGTTTACCACGAAGCTGATATTTGGTTTGGTACTT
TTCGCGGTAGATACGGCTATGACTATGCTACGATTGCCCAAATTATTTTTTGGGGCAGAGGGAGCGTCATCTGCGCATGATTTCCAGCACCTAGAGATCT
ATGTTCTTCTCGGATTCATTCGTACGGGATTAATTTTAATTTGGCTCGTGTGGATCATGAAAGTTGGTGCACGATCAGGGCAGCATTTGAAGGCGCTGCC
GTACATGGCAACTCGCTTCAAGCAACTGTCGTACCGATTTTTGGTGCTCGAGACTCTTTTAATTTTTTTCTACATCTTCGTATTGTCGGCTCTTCAGATA
TTCTACCTAACGCAAACGTGGTACTTCGTTGGTTACGACGCATTTATTCAAGACTCTATGCACACGTTTGCCAAGATGCACACTGGCCATCCGTCTCTGG
GCAAGTTTGTGTTCTTGTCGGTGTACGTGTACCTGGTGATGTTTGTACATTTGCCCCCGCTAGCGGGCAACAGTACGGGTCTGCTAGCATCTACAGCTTT
TCACGTCGACGAAAAGCCTCGCGTGGATTCGTATGGCTTCCTGACCCCCGACTCGAATTTATTTTGCGTTGAAACGGCTGGCTGGTTGCTGGAGTTGGCA
TACCAGGCATACTTTGACCCTCCTGGATGCCCTTCATCGTCTGGATATGGAGAGCTTACTCTTGAGCGATATGGCTTCGAGCTGATCACTCATCTAAGGA
GCAACTTAACGGATACTCACGTAGTTGTTGCGTGGAGTCAAGAGGATCATCGACGCTTGGTCATTTCGTTCCGTGGTACAACGAGCAAGGAGAACTGGAA
GAGCAATCTTCGAGCTGACCAGCACGTGCTGTGGATAACATCCCGAGGACTTCGCTGGAGGAAGACGTGCATCGAAAAAGTGAAGGACACTGCGGCAAAG
ATCCCTTTGCTGAACATGGCACTGCCGCGAGTTCATCGAGGTAATTACGCATATCTAGCTTTCCTTACCACAACGCTCGGGCATTTTGTTTATCTAGCGA
TGTTTGTTTTGCTGTACAGGTTTTTGGATCGCATACGAGTCAATCCGAGAAGAACTCAAGGAAGTGACACGGCTCATATTAGACGAAAACCCTGGCGTGT
CAGTGTATATCACGGGCCACAGCATGGGAGGTGCGCTGGCAATCATAGCTGCCTACGACCTTGCGGTGAATTTCAGCATCAAAGTTAATATGTACAACTT
TGGAGGGCCTCGTGTTGGCAACCCAAGCTTCCGCCAGCACTACGATAGCTGCGTCCCAACAAGCTACCGCGTCGTCATGGACGGCGACATCGTTCCGGGA
TGGCCAAAATTTGTACGTACGGCATCTGCTATTGCGTAGATGTAAAAACTAACGATGCATTCTGCCTATGAATTGTGTACGACTGCAGTGGGGACTTTAT
CAGCATGTGGGGACTGAGATCTCACTCGATGTCGCAGGCAACCTGATCGTCGATCCGAGTTTCGTGGAGCGCCACCTTCATCACTCATCTCGGCGCAAAA
CGACAATGCACGGCACAAACGTCTATCGCGTGTCAATTGCCAAATGTCTCGAAAATCTAACTACGTCGTAAAAGGCTCACAGACCCCTATTGAATATCTA
TTGACGCCACTCTATTCGATACACCTCGAGCTGACTGTGATGGTGTCCTCTTTGCTCGAAGCGTCGCAATCCGTTTCAACATTTTGGAAGAGTTTGCTTC
TTCCTAGAAGACAAGCAGCTAGTGCGCCACCATGGATGGAGACGACCAACAGGCCCAAGAAGGAGTGATCCGCTCGCACGTGGATCTTGCGGAGGCGGCA
GCGAACGGCTCTCGTGCCATGGTATGTGTGCGGCAGAATCTGCAGCTTTCGACATCGGCGCAATCTTCTAACATGATTTTGCTTCACCGCAGGTGGAATT
CCTACTGGACAATGGAGTGCACATTGATACACCTGGAAAAGGTTTGTTCCACACTTGCATGGAGATGTTTCGTTGTACATGGTATATGGAATTGACAACC
TTTTCACCAGATGGAACGACACCACTATGTGCTGCAGCTCTGTGGGGGAACGACATGATGGTCACATGTTTGCTTGACAAAGGAGCCGACGTGTCGGCCA
GGAACGAAGGTAAGCCAGACTTCTTGTTACAGAACAACGTGATTCTCGAGAGAAGGCTAACACACCAACACCTCGACAGGCACGGGGTGGACAGCTCTGC
ATGCAGCCTCATTCCAAGAGCATGGGAAAGTCGTGCGCATCTTGCTGGACAACCAGGCCGATCCTAAAATGGTCGACGCGGAGGGGCGGAGGCCGGTGGA
CTACGCCAGCATCTCCGAGGCGATTTGGCCCTTCTTCTCAGGTAGGACTGGTCACAATATGCTCCAGACCTCGTCACACTCCTGACTATTGCTCAACTTG
TATAGCTAAAGGTTGCAACAAGAGCCTCAAGTCGGAGTTGATCGCAAAAGGAATCATCCGCAAACTCCCGGACCAGCCTGAGCAGACTCAGCAAAACGAC
ATAAAAGCCGACACGGTACGTCTGTAAATGCCTCGCGCACGGCAAAAATCTGTTCCCACCTGCTTTCTCTTCGCTTCTGGCAGATCTCGTCATTCTCACG
CCCTGGATCCGCTTACACCCGAGCACAAATGTACCCGCCGCTGGCTCGCCGACAGAGCCCTGCAGTCAAGGTGGGCCCCTTCTGTTGTAGTTTTTCTTTT
GCGACTGCAGTTAGCTAACATCTTTGCTTTCATGTCGAATGGCAGTCACGCGATGGTCGTATCCTCACGGGCCCCATCGATCCGCTCGGTGACATGCCAG
CCGACTCTGACTCGAACCAGCGGCGTCCGTCCCTGAGGAGAATGGGGCTGTAGCTGCTGCACCTCAGAACCAGAACAGCCTTGGCGGACAAGGCAAGGCA
CACAAATTCTAAAAAGGCAACTTGAAGTTGCCTTTTTCCACCAATAAAAAATAGCTTGCTGCATAAAAAACGAGATATGCCATACGGCAGGTCTTTCATT
CTGTATCACCGGTTTCAGTGTGGTCCACAGTGTCTGCGCTATAGAAAAGTGCCGTTCCGTGGCCGCTCGTTTGGAGCCCCCCTTCCCTCGGCCGCTCAGT
TCTTGTATCGCTCCGGGCCCAGCACGTCGCTCTACAATGGTGAGTCCTGCACCGCCGGAAGCAGCAACCAATATACAGACATAGCTAACCTTCTTCCCCG
TCAAACGCCGCCCACAGTCGCTTCTTAACAAGGGATCGCGCGTCATGACCCAGTCGCTCCGCGCTGGCGCCCGCAACATGTCGAGCGCCACCGAGCAGGA
GGCCAAGGGTGCGTTGCGTCTTCTTCTCTCGATTGCTATTGGCGGAATTACTGACTTATTGTGTTCATATCGGCAGAGCAAATGCACCGATGGAGCACCA
TCTCCAAGGGCATGATCGGTCTCGTGGGCGTCTACACGGTGTACGCCATCGGCGACCATCTGAGCCACGAGCACCACGAGGACCACACGCCCGCCTACCC
CTACCTCAAGATGCGGACCAAGCCCTTCCCGTGGGCCGAGTCGAACTGCGACCTCCTGGACTCGGAGTGCCGCGCCAAGGCCCGTGAGGCCAAGAAGGCG
CTGGAGTAAGCAGCTGTTAGTGTCGCAAAAAGCATTTAGGGGAGGACCCTCTCCTGTATTTGAACTGACGCCTGCTATTTCGCTGTCTTCGTGTTCGTTC
GGACCTCAACTCCGCACACAACCAATTGAAGAAAAAAAAAAAAATGAAACGGAGTCTTTGTCGTCTCTTATTAACCAGCCTTGATTCACGAGTCTTCCTT
CAAGGAAGTTCCTTGACAAGCACCTTTGCAGCGTTTTAACGCTTTTAAAAGTAACAACACAAATAACGAAAAACAAACATGGACGACTCGCCAGTAGTGG
AGGTGTCCGCTCTCCAGCGCCTGCCCCAGCCCGGCGAGCCTATCTGCGTGGTAAGTCTCTTGCGTATCCCTTTAGCGCAACTTTCTTACCTAAACTTCCT
CGCCCGCCTGCAGATCTGCGGTCGATACGGCGCCTATGTGTGCGACGCCACGGACGAAGACGTTTGCAGTCTCGAGTGCCGCGACGTCTGCGTGTCCAGG
CAAAAGCAGCAATCGCAGCAACAATTTCAACAATCCGAGCAACTTCGCGCCAAACTGGGCATCAATGTCTGCTGTGGATCGGCAACTGAGACCATCAACA
ACGGGGACCTGGAGCCTCGATGGCCGACCCCATTCGTGGACTTTGCGCAAAAACAAGAAGGCGTTCAATTGCCTGAAGAGTTGCTGGTTAACTTGAGTGC
CAACGGCTTTGATAGACCCACGCCCGTGCAGATGCAGACGATCCCTTGTGTGCTGCAGGGGCATAATGTACGTATTGCGGGGTTGGAGGTTTGTGGCGTT
GCTGATATTTTCTTTTCAGGTGCTGGTGAGTGCGCCAACGGGTACGGGGAAGACGGCGTCGTATTTGATTCCAGCAGTTGCGCAGGTTTTGCGTGCGCGG
GAAGAGCAGGAGGAGATTTTGACGCTAGTTGTGGCTCCTGTGCGAGAACTGGCAATTCAGATTGAGACGGTGGCAAAGCTGCTGGTGAGAGGCATAGCTG
ACATGAAGACGGCGCTATTGGTGGGGGGATTCCCTGTCCCCACCCAGCGCTATCGACTACAAGGTGGAGTTCAGCTTATTGTGGCGACACCGGGGCGCTT
CCTCGATATTTTCATGAACTACAGTGGCGGTGATGCTATCCTGGCAGCTATTCGCATGTGTATTGTTGATGAAGTGGACATTATGCTGGACGCTGGCTTT
CGTCCACAGATTTCTCAAATCGTGGCTTTATTGGTAGCATTAGCTGGGAAAAAGAGCGTCCAGATGCTGTTTTTCAGCGCCACCGTCGCTGGCGAGGTAG
AAGAAATGGTGCGGCAAATCTTGCAAGTTCAAAGCCAGCAAAATTATATTCGCGTCGACGTTCGTCGCAGTGATTCGAAGACAACTGGGACACCGAGTTT
CGCACTCAACCCTCGTGTTAAACAACAGGTTCGATGGTCGGACGACAAGGTGAAAAAGAGTGAGTTGTTTGAGTTCTTGAAGGGAAATACGAAGAGTCAA
CGGTGGGTGAGGTGATTGCATTGACTCTTATGGAATTTCAAGCTAGCTGACATCATTGACGGGTGGCTGATACTTTTTGTGTTGCTGGCGTTGTAGATTG
TCTTTGTCGGATCGAAACTTGGCGCGAGCATGCTGGCTGAAGCCATTGAAAAACGCTGTCAAATTGGTGCAGCAGCGATTCATGCAGATAAAACTCAAAG
CGAAAGACTTCATCTGCTGGAGGCCTTTATTAATCTAGAGACCCCTGTCCTCGTGTCTACAAACGTGCTGAGCCGTGGAATGGATCTGCTGCACGTTCAG
AATGTTGTGATCTATGATTTTCCCAAGAAAGTGTCAGACTACGTTCACCTCGTTGGGCGTATCGGGCGTGGAGATGATTCGACCGGAAATGTTTTGACGC
TTGTGAATAAGGATGACCAATCAGTTTTTTGGGACCTTGTATCGCTGTTGCGGCAAGCTAAAGTATCGGTGCCTCACGAAGTGTACCAGAGTATTCACAC
TGAGAATGCCAAGTTGCGCGCTCGCTCCATCGAAGTCGTGATCGATGAATCTAAACGGGCTTTCCGAATTCGGAAGCAATTGGTTAAGGAAATGGGTACG
CACGCATCAGAATGGAAGAACTGGGACAGTCAAGAGTAAACGGCGGCGTACAAGGCCATGA