Description :
From Genome Similarity Track
Location :
Scaffold_802:9024- 11398
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_802-abinit-gene-0.17Secreted protein
Pytap_DAOMBR444snap_masked-pag1_scaffold_802-abinit-gene-0.12Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_802-snap-gene-0.6Conserved gene of unknown function

Sequence
2374 bases(100 bases per row)
CTGGTTGGCTAAAGCCTCGATACGCAGTGCAATTTCCAATGCTGGACGGTAGCACATTCTTGGCAGACCTTCAGTGATCGTATCGCTGTTTGTGGAGTCG
TCCTTTGGGCACGACAGGTCATGCATCAGTCTGCATACGTCCTTGGGGTTTTCGTCTTTCTTCTCTACTGCGCTGAAAGGGCTGGTGGTCACATGCTTCC
ATTGCTGCAGCAGATCGATGTCAAGGAGTATGTATTGCCCACCATCTTGTCCTTCTCGGATGCTACGCCTCACCGCGTTCGCATACCGAACTGCTGACTG
ATGGTTCTTGTGCCGTGTTCCGCGTCCGTCCTTCCGTGCACGCTACTGCGTGTCCAGTCCGTAGAGAGCTGTCTCAaTCATCCAGTCCAAATGCGAGTAA
CCGATCAGTAGCTTCTTGTAGCGCGCGGGATCAAGAGCCTTGTTCGGTCGCGGGTCTCGTTCACTCTCTCCGCGCAAGAGACGCACCAGGTCCTCTTGGG
AGAGACTGTTTttCTtCACAAGTTCCGAGAAGGCTCGCTTCTTTTCATGGTCGAGTACGTTCcGATTGTTCTGGCGGCTTGGCACACTTCGCGGCCTCGC
TATCTGGTTCTCCGtGAGTACGATTGCCACCTTGAGGTCCCGTATCTGTTCATCCTTGCGCAAACGAGCCTCAAGCTGCTGTTGAACTTCCGTAGCTAAA
TCTTCCGGTGGATCATGCACTACTGACAaGgCTTGAATACTGGCTAGTCGTTtGAGCTCGCGCTCGACCTCCCATTCGACGCGACTGCGCTCTGGGTCGC
GGAGCACCTCtGGTTTCTCGACAATCCGAGGTTCTGGATTCAGCTTGAACCTGACACGACGCCCTGCGGTCGTCCGTGCTCTCGTCTCTCTGCTCGTGCC
CTCATCGCCGCCCATCTCGACCGGTGTTCTCTTCCCTTGGAGGCTGGTTGACGGCGAAGAtGTTTGACTGATGTTGGACCGGTCTcTTtCAGACTGGCCT
TcGCCCCATCACTTAATCTGGATGCCAGGATACAGTCCGCCGAGGTGCTTATTGATATACTCTCCGACCTTGGCGTTGATCGTCCCcGGCCGTTCGTGGA
CGCAGTTCAGGCGACTACAGACGTTGCTTCCATCGCCTCTTCCcTTGCAACCGCTTACGGACATGTACCGAaCACACAGTTGCTTCACAACGTTGCCAAC
CTTCTTCTTTGGGaTGGCCgCCAGCACGTCTGgTgTCATCTtCGCTGGTGACgTGTTGgTACtGCTTCCtGTTCcTGtCACcGAAGCTcTGTACCTGgCG
TCTAACACATTCGCTCGGTACCGCTGCAGCACTGGGTTTGATTCTACGAACCATCCTGGTACTCTGAGTCGATCCGACGTTCCATGAATCGAGTCACGCG
TTATCGCCTGGCGGTACTTCCCCAACGTACCGTCGAGCCAAAACACCACCGTGGGTAGCTCGCTTGGCTGCCACAATTCGTACAGGCGCTGTTCGCGGAG
AAAGCGCTCTATTGCCTGTGCCACTGCAATCGTGACTCCATCACAGTTTTTCATGGCGTACTCCGTGAAGTTCGCGGCGGCAGATGTGAGGGTTTCCCAG
TCCGTGGGCACTTGAGCCGGATCCAGCGCCACCGAGGCTGAGTAGTCGAGTGTGTTGGTGGAGTCGCCTTTTTCACGTGCCGCCATGTCGTCACGATACG
TGAAAGTGCGGAAGTGCATGAGTGACAACCCTcTTGCACCGAAGCCCAAGTCGTAAACGCATGTCAACACCGCTGGTACTCGTTGGAAaCgTaGCTCCTC
GTCGGCGGATATCAGCGTACAGTATtCCATGGGATTCGTACCTTGGAGACGCTGGTTCGTCACGAGCTCGTGTGCCTTGATCCGTGAGTTATGAGGGCGA
AAATCGGTTCGACTTAGCTTGGACGTTGCTCCGGACGATGTCTCCGCGTTAGCAGCAAAGTAGGCGCGAAGAAGAGCTGGATCACGATTCATCGCTGCTA
GTTTCTCTCGTTCTGTATTGGAGTCGAAACCACCAGGGgCAAACTGACCTTACTGGAAACAGCCTGGTCTTGCAATTCGCCGAAGAAGTTtATCTGGTCA
CCTTCCTCTTTTGACTCGTCGGCCAAACGTGCCCTCTTAATCGATTCGTCATATCCACAACGCTCGGCTGTGATGAAGCTCAGAGCACGTTTTCCGCGCA
TAGGCAAACCTTCCCCACTCAAGGAACCTGGGTCCTCACCAATTGAGTGTCCGATCACCATTCGAGCCGCCAAGTCCGCCGGTCGTCCACTTCGCTCGAA
ATAGGTGAACCGAATTGCGTGGTCTATGGTGGTATAGTTGGCCACTCCCGTCATTTTATTGACCCACTGAACCA