Description :
From Genome Similarity Track
Location :
scaffold_13:90232- 91312
Transcript NameFunction/comments
g814.t1 hypothetical protein PHYSODRAFT_298513

Sequence
1080 bases(100 bases per row)
TCCTATTCCTTGGACTGCTGCCCCCGATCATCCTTGAGGCAGGCTTCAATACGCAACGCAAAGGCTTCTTCAGTAACTTCTTCGCCATTTTATTATTGGC
AATCGTCGGTACTCTATTGGCGACATTCGCTACGGGAGGGATCCTCATTTGGCTGGGCAGTATGGGGGTCATCACCCAGCTCACCTCGGCCGAGGCGTTT
CTCTACGGATCTTTGATCTCTGCTATCGACCCCGTTGCGACGTTGCTGGTGTTCAAGAAGTGCAGAGCCCCGTCCCTGCTCTTCAACTTGGTCTTCGGAG
AGAGCGTGCTCAACGACGCTGTAGCCATCGTCATCTTCACGCTCTTCCAGAAGTTCGTGGAGAGTGGCAACACCGACGTCAACGTCGAAGTGGCCATGTC
CATGGTGTTCAGGCTGTTGAGTATCGGCGTGGGCTCTGTGGCTCTATCTGGAGCCATCTGCTTCTCGTCGGCTTACTTTCTGCGTCACTCAGACCCAGAG
CTGCGTCAACACCCGATCTACGAGATGTCCATCATTCTGCTCAGTTGCTACGCCAGTTACTTGGCAGCGGACCTGTTTGAGCTCAGCGGACTGCTGGCAG
TTTTCTTCAGTGGTGTGTTTATCCGGCACTACCACATGTACAACATCTCCAAGGCCAGCGCCTTCGCGTTCAAGCAGCTGCTGTCGACGATGGCGTTCTT
GGCCGAGAACTTCATCTACCTCTACTTGGGACTGAGTGTGTTCGCCTACCGCGACTCACTCGTGTGGGATTGGGGCTTCATCTTCGCCAACTTGGGCGCT
TGTCTACTGGCTAGAGCATTCAACACGTTCCCGTTGTGCTCGTTAGCGAACTTGGGGCGTTCGGAGCAGCAGAAGATTCCCTTCACGTACCAGATCGTGA
TCTGGTTTTCTGGTCTGCGTGGGGCCATTGCCTTCGCTCTGGTACTAAATGTATCGACGGGAAACCCCATCCACGCGGCGATTCTCAAGAGCTCGACGCT
GTTCCTAGTGTTGTTCACCACAGTGTTTTTCGGAGCGGCCACGGGTCCCCTGCTTCGGCTGTTAGGACTAACTGGCGATC