Description :
From Genome Similarity Track
Location :
contig_9:90225- 91764
Transcript NameFunction/comments
g2218.t1hypothetical protein

Sequence
1539 bases(100 bases per row)
GCGCTTCGGCATGGCGGCGAGGTGAACATTTGGAGTCGCGAATACATCGGCATTGTCGCACAATATGCCGCTGTGGGCATGATCTTTGGTACGCTGCCCG
GCACAGTCTATCCATTCTTCTTCAACTACCTCAACATGGAAGGCACACAGTCGTGTCGGCTGTGGTTCTGCTCAACATGCCGTGGTCGTTCAAGATTTTT
TACGGCATGATCACGGACTGTGTTCCTATCTGGGGCTACAGACGTCGTCCGTTCATGGTCATGGGGTGGACGTTGTGTTTTACGATGCTAGTCGTTATGG
CTGCATGGATGCCGGCGACCCTTATTACCCAGACAACAAGTACGCGACGATGGATGAAGAGGAGCTAACCCCTGAACTCGTTGCGACTTTCAACGAGTCG
GCACACCACGCGGGTGGAAATTTATCGCGTTGATGATGATCGCTGCGGTGGGGTACGTCGGAGCCGATGTTGCTGCTGATGCATGATGGTGGAAGTAGCC
CAACGCGAGCCAGAGGCTACGCGAGGATACACGCAGACCACGATCTACATGGTTCGAACTGCTTTCGTGACCATCGCCAGCATTCTCACTGGTTTGGCTT
TCAACGGATCGCACTATGGAGGAGACTTCAACTTCTGCCTGTCCTTCCCTCAGTTAATGGTGATCCTCAGTGTTTGTTGCTTCCCCGTGATTCCTCTCTC
ATGGTACTGCATCAAGGAAGAACATCACCCAGGCGTGATTTTTCGCGACTACTTGGCCGAGCTCTGGTATCTCATCCAAACACGCCCGATGTACCAAGTG
ATAGCGTACAAGTACTTGGCCGGCATTTTCGAGAACTTCACCATTACATGTGCAGACCCGATGCAATCGTACTGGGCAGAAGTCACACCGCTGAACCAGA
AAATTATGACAATTGTGAGCAACGGCGTTTTCGCCATCGCACTGTACTATACTGGCAAGAATGGCCTCCACTGGAACTGGCGAAAGATGCATGCTATCAC
CATTGTCTCGGTGACAATCATGGACTTCATTGTAACGATGCTCACGACATGGAATGTCATACGCAACCAGTGGTTTTGGCTCGGAGTGCCCGTGGTGGAG
AACCTTCCGAATGGCATCTCTTTCGTGATCGGAACGTACGTGATCGTGGAGCTGGCCGGTGAGGGTAACGAAGGTGCTGTGTACGGACTGGTGGGATCGA
TCTCCAACATTGCGATCCCCCTGGCCAGCACATTCTCCAAGAACGTGGGCAGCCATTTCGACGTGACCAACCCGATATCGTCGAAGACTCGACCCACGTG
CGCTGGGAGGTGACGTACGTTCTCATCATCCGTTACTCGATGAACTTGGCCGGACTTCTTTTTCTCCCGCTACTGCCTCGCCAGAAAGCGGAGACGCAGC
AGCTCAAGCTCAACGGCGGCTCTAGCCGTATTCTGGGGATCGTGACATTATTGTACTTCATCATCTCGTTGGGCTGGACCGTCATGGTAAATATCATGAG
CATTTACCCGTCCACATCGTGCCTACCGATCGCTGGTGG