Description :
From Genome Similarity Track
Location :
contig_15:902209- 913569
Transcript NameFunction/comments
g4179.t1hypothetical protein
g4180.t1hypothetical protein
g4181.t1hypothetical protein

Sequence
11360 bases(100 bases per row)
ACGGTCGTACACACCAAAGGACGTTGGCAAAGGATCGCGGACACCCACGTGCCATTGCCACCAAGAAATGCTACAAGAAAGCTTAGGTGGTGGCGGGGAG
TCCGCTGCTAGCGCGAAGAAAGCGTTGACACAAGCCCAGAAATTGGTGCACCTTGCTTCAGTCAGACCCAATGCGCTGACGCTGCGTGAATATCGCGAAG
GACTGGAGGTTAGTTGATGAGGAGGGGTCGGTGACTCGAATGTATCATCCTAATCACTTGCGGTATTGTGTTTAGGAATGCCTGAAGCCGGAAGGCAGTA
CGGTGATGAAGGTTCTGGGATTTCAACTGGCTGGTACTGCTCCGGGTTGCTCGACCAACGAGATCTGGAAGTTTGTGTTGGAGGCAATCGTCACGGAGCT
TGGTAACTCCGAGAATCCGTCAGCCTTAGCCGCTGCAGTTCCTGTGCTTGGGCTCATTCCGGTGCCTCTTGTGCTGGGCTTTTTGCTTTCTCCTGAACGG
GAGCCCATGAACAAGCTGCGAACAATACTGACGCACGAAGACGTTGAGACACGCTGTCGCTCGATCGAGATGCTATCCAAGCTAACGCTAGATATCGCCA
TCAGTGTTACTGGTGATGGTTTGTTTGTCTTTCCATTCGAGTCGCACGAAGCGCGAATTTGCTGCCAGCAAGACGTCGAGACCATGGTAATCGACTGCTG
GAAACTGATTTTCCACACCCTTTCTTTCGATGAACAGTCCCAGACTGCGGCGTGGGCTGCCGGCACTGCGTTTACAGCCTTGACAAATCTATTTGCTCGA
TGCAGTACGATGACAGCGTTTTTTTCAAGCACTCGAGAATCTACCCGAGCGCAAGCTCCTATAGACGACGTTGCCTCTGTGATGTACAAGCACGCATTTC
CTCGAATTCGAGCGTTGGTTGTTGTTGCGCGCGCTCTTCCCATGAAACAACAACCGGATGCCATGCTCTGGATCTCTATGCTGCTTTACACTATGATGGA
GCGTAGTGGTGCGAGATGCCCTAGCATCAGCGTACCTTACGTTGAGATTGATGCTGATAACAACAATGTCGATGGTGCCGATGAAGACGATGATGAATCT
CACGCGTCTACCGAGCCTGTTCGAGTGGATGAACTGGTGAGTGATTTGCTCGAGTCCTGGGCATTTCCTACGATATCGAGAAGAGTATCTCTGGCGCAAG
CGTCCAGCATGTGCCGCGCCATTTTTATTCTGCTGGCGCACCCTCTTCAAACACTCACCCGCATGCGATGGGGTGCGCAACTGACCAACCATCTCATTGC
CCAGTGCTACCTTGCGAATAAGAGCTCAAGCAGCACCAACGGAGTTGACGTTAAACGTGAGCTATGTGTGATGCTCGTGAAAACATTTGCGTGGCTGTCC
GGAGTCAACTGCCAATCACTCTTCGTGCGTACAACTGAAGCTATCTACCTCGTCGACCAGGACAAAGACCGCCGTGATCTTGTGCAGTCCCTAATGGACA
CGATCGCTGCACACATTGTGGCTAATCGAGATTTTCAACTGCTCCAGGGGTTGTGCACGATGACTTTCTTCAGACAACCCAGGGGCTTCTCCAGATTGTC
ACCACGTACCAATGGCTCAGAGGTGTTTCGAGCACTTTTTCAATCTCTCTCCAACACAGCAGACCTACCACCTCGGCGCGGGGCCATTGAGCATCAGGTG
TCCCAGCTGATTGCCTTGAGGGTCTTCAGAGGGCTTTTACTATTGAAACTAGGCGGGTCGGCCACGACTTCGCCCAAGGCCTATCGACGGTCCTGCGAGA
TCAGCGAGAACATCGTTTACTACACGGGCTTGCTGACATCGCACTTCCAGGGCATGCTTGCATGTCCCGAGCTCACCCTTCGTGAGTCGCTCGACTTTTT
CCAGCACGAGCTATTCCCGACAATGGACCAAATCGCATCACAAAGTGCTCGTCTTCAGATACTTTGGATTGGAGTGCGTCTTCACCGCAATTACGCGGCG
CACGTACCTTTTGAAGTTCTGGTTCGAGAGCTACAGCACGAGACTGGTCGCCTTTTCACTGCTATCTGGAACGATGACGACGAAATGGAGGGAGCGACTT
TCGACAATGGATTGCTGGGATGCGGTGGCACTGGCGAGGACACACCTGCGAACCGTAAACGTGCGGGAGATGCTAACACTGTCGACACATTGATGGTGCT
TGGTGACTGCATTACACTGCTGGCACAATTCCAGCCCAACACGCAGCCCCAGTTTATCCAGATGTGCGAGAAAATGATCGCTGCGCTATCGGCTTCAGGA
AGTTCACCGGCAGCAACATCTCAGCAGTATCGAATGTACGTAGACCAAACCGAATTATTCCTTGCCATCGACAAGCTTTACTAATCATGACCACATTTGC
AGCATTGAGGACGTTGTAGCTCTCCTTTCGACTCCTTCGACAACGGATCTTGCACCTGAAGACCCGTATTCGACAGAGATTTTTGACCCGCAAGACATTT
TCCTGCCACGAAAGCATTTTGACGAGCATGGCGACACGACTAACCCGGAACTTCCTCAGGATGAAGAAATCGGGAGCCGGTCACTGTCACGGGTAGTGCT
GACCCCGTCTCCATTCGGATTTCTCATCACCACCCGTTAGCAGGAAAGGAAGAAGTGATCTCTCTCGAGGTCAGCTGCTGCAACCTCACTACATGGCCCC
TGAGCGACCTGGAAATTCAGCTTCATCCGCTCGGAGGTGGGGGCGTTGTTCAATGTGTGGACAAGTCCAAGGAATTAAAACTGCGTTTGCTACGTACCGG
TGAGACTGCGAGCGTTGGTACAAGCGGAGGCAGTACCAGCTTGCCGCCGTTTGGCGTGATCAAAGCGGAAAAAAAGTTCCGTGTGTGCAAATTCACTCAG
CCCAGCTTTCTGGTGCAAGCGGTCTTGGTCCGAGAACCTAGTCAAGACGGTGAAGATATTGGTGGCAATCCTGCAGAGGAGGCGTTCGCTACTCCAATTC
GTTTGGCCTTTAGTAGCCCCTATGTGGTTCACTTCGACACACTCCTTCGACTGCCCCAGTCCCAGTTTGCTACCGCTGCGTACTTCCAACATTGCTGGCA
AAGGTACGACTTGACTGCAACTCTTTTTATTGCTCAAAGGTTCCTCAGTCGCCTATCGTTCACGTCTGCGTTCTAGTTCCAACGCGAGCGTTCTGTGGCC
CATCAGCGCACAGACCTCACAGGAAGTCGAACTAAGTGTTTGCCAACACACGCTCCACTACATGCATGCTAAAGTTGCAGCGGCTCCCGAGTTGCAGCTC
GAGCTACCCATGCACTTTCACGTACGTTCTCCGCGTCATTCTAAACTGTTTCCAACCCCCGTACTCATCTCTCGTAATTTGTAGATTGCCATGCTCACTC
AGACGAGATGGGGCTCCTATGTGGTGGCATCATTGACCATGAGCCTAGACTCGAATTCTCATCTTCTGCTTGGTCGGGCGCTGGAAGTCCGGTCGACTTG
TGAAAACATCCGCGAATTTGAGAAGTGGCCGAAGGACGCAGTTCGTCTCTTTGCTGGGGAGATCGTGCAGCTCTGCAGTAGACCGGCATCCGCACTTTCT
ACTGCTTGTGAGAGTGCAAACTCGTCCGATCAGGCCAGCAATGCTGTCAGTGCAACGCCCTCCCTTCCAAACCCACCACCTCTGATCTCCAACGCGTTGC
CAGCTGCAGCCCCGGCCCCAATGCAGGTTGCAAACGGAATGCCGTTCACCGCGGCAGACCCCGTACTGCCCACCGCCTTCGCACCGGACGTGCGGTCCAC
CACGAGTTTCCACAAAGACGTGGGTGCTCCCAGTGACCGAAAGACCTCATTCACTCGCTCCGAGCAAGTCCGAGCGCCAGAAACATCCGCACAAGGCGAT
CAGTGGGGGACCTTCCTCTGAAGTTGAAGGCAGCTTCAACTTGATGTAGCACAACACCAAATTCGCCGGTCGGAAGATCATCAACCCGCTTTTTCATTGG
CTAAAACTCGTATTAAATCACTTTTTCTCGCATCAAATCCAAGATGCGGCCTTCGGAGCACCAGCGCGGTACTGCCGGTGCGTATCGAGGGAGCGAACAC
GCGAGCGAGGAACGCGTATACCGCCCGCTGCTGTTCCAGTCCACGGGTTATGCGTCTTCGGAGCTCTTCCGCGACTCGTATGAGATGCACTCGCGCCTGC
CGACCGCGCCTCTATTAGGAGTAGAGACTAGTGCCGCCGAACCAGAAGAGAATCAGAAAAAGCGTCATGTGTTCGAGCCACAGATCCGACTCGAGACGCT
ATCGTCGCGGGCTGCTACAGCAGTGCTTTGGGTCACGTATTTGGTGTTTTTGCTTGCGATGGCACTGCCGTATTTGCAGAGCAAAGGGTACCTGGAAACG
GTGAGGACTATTTTTTAGGACTATTTCTGATTCTTGAAGACTTTTGTGACGCTTTTTGTGATTTTCAACATAGGCGGTGGAACTGCCGGGAGGGGTTTGC
CAGACAGAGAAAAAAGTGGGAGAAGAGCCGTGCATTCAAGTGGACAAGACGAGGAGTATTGCTCAATGGACAGCGTACGTGACGAATGTGTCGCGGTACT
CTGGTTCCATTGAGATAAAGCTGGACGTTCGGGAGCAGGTGAACGCTTCAACCTCGGTGGCTTCACTTGTGGAGAGCAACACGTATCAGGAGCTGGAACG
TGTGGGCACAGCGTGGAAAATGGATCGAAAAGCAAACAGAGGAAATAGTAATTTAGAGAACGAAGCCTCGAGCATTTCGGAGGTTGCGGAAGGGGAGGTT
GACCAAGAGGCAGGATATGTATTGACCTATGACGCCAGGCTGTATGGTATTGATCACGAGGTGACCCCTGCTACGAAGGATCTTGTAACAGATGAACGGA
ATCAGAGTATTTGGATCGAGTGCCGATCTAGCGAACCGTGTGAAGTTGTTCAACTACTGGAGATTACGCAAGACGTTGATCGACTGGTGAGAACACTAAG
GGAGATGAATCGGATATTATTTGTGTGATTGACCTTTTGGTTGTATGATATCTTTAGGGTGGAAGCGGATACGACGCGTATTTTGTCATCGTGTCTTTTA
GAGGGCTGTATCCAAACGTCTTCGGCAAGGATGTGGTTTATCAATTCGCGTACACGTACGTACAAATTGTTGTTGCTGAAGTGAGTTACGCTTATTCGGT
GAGCACTAACTTGCTAAATTATGTTATCCAGTAAGCCAGCTATTCACGTTGGCGAAGTTATTGTGCGTGGAGTAATGGTGTTAGCATCCATTTTGGCGCT
CCCTTGCTGGTTCATTTCAGTTCTGAATTTCCACGGTGGATCATGGAGCCAAGTGCTTACCGTACAAAAGTGGTTACTGGGAATTGGCGTCGTGCTCGTA
CTCTGGCAGAACCCAGTGTACGCAGTGTCTCAACTGTACACAACCGTGAGCATGCGCACGCGATTTGTGTCGATCACTAGTCAATCACTTGCGGAGGCTT
CTTTCTACGTGTTCTGGCTGAGTCTCATGGACCTACACAGCGGTGATTTCACGTCTCGAAGATGCGCGTTTACCACGAAGCTGATATTTGGTTTGGTACT
TTTCGCGGTAGATACGGCTATGACTATGCTACGATTGCCCAAATTATTTTTTGGGGCAGAGGGAGCGTCATCTGCGCATGATTTCCAGCACCTAGAGATC
TATGTTCTTCTCGGATTCATTCGTACGGGATTAATTTTAATTTGGCTCGTGTGGATCATGAAAGTTGGTGCACGATCAGGGCAGCATTTGAAGGCGCTGC
CGTACATGGCAACTCGCTTCAAGCAACTGTCGTACCGATTTTTGGTGCTCGAGACTCTTTTAATTTTTTTCTACATCTTCGTATTGTCGGCTCTTCAGAT
ATTCTACCTAACGCAAACGTGGTACTTCGTTGGTTACGACGCATTTATTCAAGACTCTATGCACACGTTTGCCAAGATGCACACTGGCCATCCGTCTCTG
GGCAAGTTTGTGTTCTTGTCGGTGTACGTGTACCTGGTGATGTTTGTACATTTGCCCCCGCTAGCGGGCAACAGTACGGGTCTGCTAGCATCTACAGCTT
TTCACGTCGACGAAAAGCCTCGCGTGGATTCGTATGGCTTCCTGACCCCCGACTCGAATTTATTTTGCGTTGAAACGGCTGGCTGGTTGCTGGAGTTGGC
ATACCAGGCATACTTTGACCCTCCTGGATGCCCTTCATCGTCTGGATATGGAGAGCTTACTCTTGAGCGATATGGCTTCGAGCTGATCACTCATCTAAGG
AGCAACTTAACGGATACTCACGTAGTTGTTGCGTGGAGTCAAGAGGATCATCGACGCTTGGTCATTTCGTTCCGTGGTACAACGAGCAAGGAGAACTGGA
AGAGCAATCTTCGAGCTGACCAGCACGTGCTGTGGATAACATCCCGAGGACTTCGCTGGAGGAAGACGTGCATCGAAAAAGTGAAGGACACTGCGGCAAA
GATCCCTTTGCTGAACATGGCACTGCCGCGAGTTCATCGAGGTAATTACGCATATCTAGCTTTCCTTACCACAACGCTCGGGCATTTTGTTTATCTAGCG
ATGTTTGTTTTGCTGTACAGGTTTTTGGATCGCATACGAGTCAATCCGAGAAGAACTCAAGGAAGTGACACGGCTCATATTAGACGAAAACCCTGGCGTG
TCAGTGTATATCACGGGCCACAGCATGGGAGGTGCGCTGGCAATCATAGCTGCCTACGACCTTGCGGTGAATTTCAGCATCAAAGTTAATATGTACAACT
TTGGAGGGCCTCGTGTTGGCAACCCAAGCTTCCGCCAGCACTACGATAGCTGCGTCCCAACAAGCTACCGCGTCGTCATGGACGGCGACATCGTTCCGGG
ATGGCCAAAATTTGTACGTACGGCATCTGCTATTGCGTAGATGTAAAAACTAACGATGCATTCTGCCTATGAATTGTGTACGATTGCAGTGGGGACTTTA
TCAGCATGTGGGGACTGAGATCTCACTCGATGTCGCAGGCAACCTGATCGTCGATCCGAGTTTCGTGGAGCGCCACCTTCATCACTCATCTCGGCGCAAA
ACGACAATGCACGGCACAAACGTCTATCGCGTGTCAATTGCCAAATGTCTCGAAAATCTAACTACGTCGTAAAAGGCTCACAGACCCCTATTGAATATCT
ATTGACGCCACTCTATTCGATACACCTCGAGCTGACTGTGATGGTGTCCTCTTTGCTCGAAGCGTCGCAATCCGTTTCAACATTTTGGAAGAGTTTGCTT
CTTCCTAGAAGACAAGCAGCTAGTGCGCCACCATGGATGGAGACGACCAACAGGCCCAAGAAGGAGTGATCCGCTCGCACGTGGATCTTGCGGAGGCGGC
AGCGAACGGCTCTCGTGCCATGGTATGTGTGCGGCAGAATCTGCAGCTTTCGACATCGGCGCAATCTTCTAACATGATTTTGCTTCACCGCAGGTGGAAT
TCCTACTGGACAATGGAGTGCACATTGATACACCTGGAAAAGGTTTGTTCCACACTTGCATGGAGATGTTTCGTTGTACATGGTATATGGAATTGACAAC
CTTTTCACCAGATGGAACGACACCACTATGTGCTGCAGCTCTGTGGGGGAACGACATGATGGTCACATGTTTGCTTGACAAAGGAGCCGACGTGTCGGCC
AGGAACGAAGGTAAGCCAGACTTCTTGTTACAGAACAACGTGATTCTCGAGAGAAGGCTAACACACCAACACCTCGACAGGCACGGGGTGGACAGCTCTG
CATGCAGCCTCATTCCAAGAGCATGGGAAAGTCGTGCGCATCTTGCTGGACAACCAGGCCGATCCTAAAATGGTCGACGCGGAGGGGCGGAGGCCGGTGG
ACTACGCCAGCATCTCCGAGGCGATTTGGCCCTTCTTCTCAGGCAGGACTGGTCACAATATGCTCCAGACCTCGTCACACTCCTGACTATTGCTCAACTT
GTATAGCTAAAGGTTGCAACAAGAGCCTCAAGTCGGAGTTGATCGCAAAAGGAATCATCCGCAAACTCCCGGACCAGCCTGAGCAGACTCAGCAAAACGA
CATAAAAGCCGACACGGTACGTCTGTAAATGCCTCGCGCACGGCAAAAATCTGTTCCCACCTGCTTTCTCTTCGCTTCTGGCAGATCTCGTCATTCTCAC
GCCCTGGATCCGCTTACACCCGAGCACAAATGTACCCGCCGCTGGCTCGCCGACAGAGCCCTGCAGTCAAGGTGGGCCCCTTCTGTTGTAGTTTTTCTTT
TGCGACTGCAGTTAGCTAACATTTGCTTTCATGTCGAATGGCAGTCACGCGATGGTCGTATCCTCACGGGCCCCATCGATCCGCTCGGTGACATGCCAGC
CGACTCTGACTCGAACCAGCGGCGTCCGTCCCTGAGGAGAATGGGGCTGTAGCTGCTGCACCTCAGAACCAGAACAGCCTTGGCGGACAAGGCAAGGCAC
ACAAATTCTAAAAAGGCAACTTGAAGTTGCCTTTTTCCACCAATAAAAAATAGCTTGCTGCATAAAAAACGAGATATGCCATACGGCAGGTCTTTCATTC
TGTATCACCGGTTTCAGTGTGGTCCACAGTGTCTGCGCTATAGAAAAGTGCCGTTCCGTGGCCGCTCGTTTGGAGCCCCCCTTCCCTCGGCCGCTCAGTT
CTTGTATCGCTCCGGGCCCAGCACGTCGCTCTACAATGGTGAGTCCTGCACCGCCGGAAGCAGCAACCAATATACAGACATAGCTAACCTTCTTCCCCGT
CAAACGCCGCCCACAGTCGCTTCTTAACAAGGGATCGCGCGTCATGACCCAGTCGCTCCGCGCTGGCGCCCGCAACATGTCGAGCGCCACCGAGCAGGAG
GCCAAGGGTGCGTTGCGTCTTCTTCTCTCGATTGCTATTGGCGGAATTACTGACTTATTGTGTTCATATCGGCAGAGCAAATGCACCGATGGAGCACCAT
CTCCAAGGGCATGATCGGTCTCGTGGGCGTCTACACGGTGTACGCCATCGGCGACCATCTGAGCCACGAGCACCACGAGGACCATACGCCCGCCTACCCC
TACCTCAAGATGCGGACCAAGCCCTTCCCGTGGGCCGAGTCGAACTGCGACCTCCTGGACTCGGAGTGCCGCGCCAAGGCCCGTGAGGCCAAGAAGGCGC
TGGAGTAAGCAGCTGTTAGTGTCGCAAAAAGCATTTAGGGGAGGACCCTCTCCTGTATTTGAACTGACGCCTGCTATTTCGCTGTCTTCGTGTTCGTTCG
GACCTCAACTCCGCACACAACCAATTGAAGAAAGAAAAAAAAATGAAACGGAGTCTTTGTCGTCTCTTATTAACCAGCCTTGATTCACGAGTCTTCCTTC
AAGGAAGTTCCTTGACAAGCACCTTTGCAGCGTTTTAACGCTTTTAAAAGTAACAACACAAATAACGAAAAACAAACATGGACGACTCGCCAGTAGTGGA
GGTGTCCGCTCTCCAGCGCCTGCCCCAGCCCGGCGAGCCTATCTGCGTGGTAAGTCTCTTGCGTATCCCTTTAGCGCAACTTTCTTACCTAAACTTCCTC
GCCCGCCTGCAGATCTGCGGTCGATACGGCGCCTATGTGTGCGACGCCACGGACGAAGACGTTTGCAGTCTCGAGTGCCGCGACGTCTGCGTGTCCAGGC
AAAAGCAGCAATCGCAGCAACAATTTCAACAATCCGAGCAACTTCGCGCCAAACTGGGCATCAATGTCTGCTGTGGATCGGCAACTGAGACCATCAACAA
CGGGGACCTGGAGCCTCGATGGCCGACCCCATTCGTGGACTTTGCGCAAAAACAAGAAGGCGTTCAATTGCCTGAAGAGTTGCTGGTTAACTTGAGTGCC
AACGGCTTTGATAGACCCACGCCCGTGCAGATGCAGACGATCCCTTGTGTGCTGCAGGGGCATAATGTACGTATTGCGGGGTTGGAGGTTTGTGGCGTTG
CTGATATTTTCTTTTCAGGTGCTGGTGAGTGCGCCAACGGGTACGGGGAAGACGGCGTCGTATTTGATTCCAGCAGTTGCGCAGGTTTTGCGTGCGCGGG
AAGAGCAGGAGGAGATTTTGACGCTAGTTGTGGCTCCTGTGCGAGAACTGGCAATTCAGATTGAGACGGTGGCAAAGCTGCTGGTGAGAGGCATAGCTGA
CATGAAGACGGCGCTATTGGTGGGGGGATTCCCTGTCCCCACCCAGCGCTATCGACTACAAGGTGGAGTTCAGCTTATTGTGGCGACACCGGGGCGCTTC
CTCGATATTTTCATGAACTACAGTGGCGGTGATGCTATCCTGGCAGCTATTCGCATGTGTATTGTTGATGAAGTGGACATTATGCTGGACGCTGGCTTTC
GTCCACAGATTTCTCAAATCGTGGCTTTATTGGTAGCATTAGCTGGGAAAAAGAGCGTCCAGATGCTGTTTTTCAGCGCCACCGTCGCTGGCGAGGTAGA
AGAAATGGTGCGGCAAATCTTGCAAGTTCAAAGCCAGCAAAATTATATTCGCGTCGACGTTCGTCGCAGTGATTCGAAGACAACTGGGACACCGAGTTTC
GCACTCAACCCTCGTGTTAAACAACAGGTTCGATGGTCGGACGACAAGGTGAAAAAGAGTGAGTTGTTTGAGTTCTTGAAGGGAAATACGAAGAGTCAAC
GGTGGGTGAGGTGATTGCATTGACTCTTATGGAATTTCAAGCTAGCTGACATCATTGACGGGTGGCTGATACTTTTTGTGTTGCTGGCGTTGTAGATTGT
CTTTGTCGGATCGAAACTTGGCGCGAGCATGCTGGCTGAAGCCATTGAAAAACGCTGTCAAATTGGTGCAGCAGCGATTCATGCAGATAAAACTCAAAGC
GAAAGACTTCATCTGCTGGAGGCCTTTATTAATCTAGAGACCCCTGTCCTCGTGTCTACAAACGTGCTGAGCCGTGGAATGGATCTGCTGCACGTTCAGA
ATGTTGTGATCTATGATTTTCCCAAGAAAGTGTCAGACTACGTTCACCTCGTTGGGCGTATCGGGCGTGGAGATGATTCGACCGGAAATGTTTTGACGCT
TGTGAATAAGGATGACCAATCAGTTTTTTGGGACCTTGTATCGCTGTTGCGGCAAGCTAAAGTATCGGTGCCTCACGAAGTGTACCAGAGTATTCACACT
GAGAATGCCAAGTTGCGCGCTCGCTCCATCGAAGTCGTGATCGATGAATCTAAACGGGCTTTCCGAATTCGGAAGCAATTGGTTAAGGAAATGGGTACGC
ACGCATCAGAATGGAAGAACTGGGACAGTCAAGAGTAAACGGCGGCGTACAAGGCCATGA