Description :
From Genome Similarity Track
Location :
Scaffold_1159:902- 2204
Sequence
1302 bases(100 bases per row)
CAGGTACACAAATGGTTGTATGCCTGTTAGCAACACTGTCAGAAAGGCGCGCTGCCCCAGAGTGGCAGTGCTCGCAGCAAATCCCGAGGGGCCCTGCGCA
GTGGATCCTCGCCGCCGGTGTCTCGCCGTGCAAGAGATCTAAGCTTGACAGGCTTCGtgaagttctcgaagcgtTCACGTGCTGCGGTTGTCCGAGCAAG
GTACCCAGTAGGGTCTTTGTTAAGGTTTCAATAAAGACATTCCAGCTTTGACAAAGTGGCTGATTGGCATCCACTTTGCTATTGCGAGAAGTTTTTTTGC
TTGTAAAatgtcggagctcatggatAAGTCCGACATAGTAGGCGCGTCTTTGCTTCGTTGACGAGTCAAAGTTCTTGGCATTTGCCACGTGCAAGAGCAT
TCGTTTGGTGATCCATTAGCGCCATATCTGTCCACCATCTCGGGTATGGTCCGCATCCACGGATCGAGCACTGTAGTGTCAGTGCGTGGCTCCTGCTGCG
GCGAGTGTGTTGCAATTTATTCGCTTCGTGAGCGCTTCAGGCTAGAAGCGCTCGAATCATCTTCGAGGGCAGCATGAGGGATGTGCGCAACGTCAGCTGA
GGACACGAAGTCCTTTCGCTTTGAAGACGAGCTCTTTTTGTCTTCCATATATTGACCCTCCACCTCGAAACTATATTAAGCGCCGAGCACCGTACCGGAG
CCCCCGTCAGTGGAGACTACATGAACAGGCTTTGATTTGTCTGTCTTAGCGGCATCACTTcgtttctgcttctgcagagcCTGATAACCCGCGCCAGAGA
GGTTACCCGCTGTCGCAGCGCTTAATGTTGTCGGCGATGGCGGTTGGCGAGCTCATTGCAGAATCAGTTCGAGTTTTTCgtggtgtaacggggttacacg
cAAAGTGGCTACACTACTTATGAGCTTCCAGAAGTagcttctgttagaagttaggGATCTCCTGTCTTGGTGTGTGGTACACCAACGGCTACATTTAGGC
AGACGACTGATCCGCGTGTATTTAGGGATATCACTGTTAATagcagcatatttctaccaattagaatcataaGATCCGCCGGCCACCAGTCGGTAAAACC
GTTATTACATGATATCGCATTAAAGAGGAACCCCAAGCAATAGTCTAAATATAAAACCTGTTCAGTTCTCAAGTTTACATTAAGTGTTTAGTACCTTTCT
TTAATCTAGCTgtaattatacttgcaggacaagtataatagagttaagtaTAAGAAACCTACGTTTCCTCGTACATGTGCGGATTAGTAGTAGACTAAGT
ag