Description :
From Genome Similarity Track
Location :
Scaffold_29:90176- 95560
Transcript NameFunction/comments
Hyaar_Emoy2804478hypothetical protein
Hyaar_Emoy2804479putative zinc finger protein 2

Sequence
5384 bases(100 bases per row)
GACGGGACCATTCCTCGAGCAACCCACAAGCACTACTTGCTACCCAAAAAACGAGTCGGCACTCGACTCGACTGAACGACAGTTGGAAGGGTGGTAGACC
AACCAAAGAATACAAAGCTATACACACGGCGTAAACTCGTATCAAGGTACAAAATATGGCTAAAAGTACATCGTCCAAGTAGCTGCTTTATATGTCGGCG
TCAAATACAAAGATACGATATACGGTGTCCATGTCAGTGTTTATCTCAAAGTCTGGCGCCGCAGAACTTGGCCATCCTGGCGAAAGCTGATGAGGAGCGC
CTTGTCACTAGCAAAATCGAGATTTATCTTTTTAGCGTGTTTATTTATCATTCGATACTACACAAATGATCAACATTTGGCCTGGCGTCACACTCAATTT
AGTCATGCTTACGTATAGTACACGCCTTGGTATCATTTCGTCATCTTGTTGGTATTTTTCCGTAGTATTAGGAATATTTTTATTTTTCCCAAATGCATAT
GATGAACAATTATACTGGCAAACATGTCGCCTTTAACGTGTCTTCATTGTTGTAGTTGTTGGTAACCCGTCAATGTATCCATCACGCCACACACATTAGA
GTGCAATTTACTCGCGCCTAACAATAAAGTGGTCGGAACAACGAAACAACGTATATGTGATACTTGAAGAAGCAAAGTGCATCGGACAATAACTCTTGTC
CTGCCTCCAGCGTTGAAAACGTTTGTGATTAATGGCTGAAAAATTCGCATAGGCTCGACACGAATTAAGTGAAAAGAACTGGACTTCCAGATACATGCGG
CCACCCGGTTGTCGTTTTCATAGTCGTCGTTTGTGTTGTAGTCTCTAGCATCATCGGCGTCGCTTTCCGGTATCCGATTCTCCATTGCAGCTCTTTCAGA
ATATCGCCCACCTTTTTATATGCTTGTACATTTAAATCGTCAACTTCCCCACTGCCCATGCGTGAAATGATGTCTGCTTTTTACTCTACCTTCTCGGACC
CACTACATTTGATCGGAGTCGCCCGATATGATGACAGGGTCATCACCGCAGCGTATAATAAAAAAACAATCGAGATGTCCAGCTATCAACAATTGTAAAA
ACGGATCTATTACGAAATTATATCAGCAATTACAAGCACAAAACAAGTCCTCACGACACAGTAGCTTAACGACTATAGGATTATAATTCGTCACAATTGC
TCAGAGTGGCTTTTATCGACTCGTTCTTAGTGGAAGACCATTGTCCGGACTTGATGATTGGACATCTGGCAGCTGAGCGGAGATAGGTGGCCGTGAATAT
ATATCAAACCCAGCGGCAAGATTAAAGGGACCACTTATCGTTAACAGACGCACAAAATACTGCTCAATGGGTGAATTTACTCTCTCTTTCTACTAGATGC
TACACTAGATACTGGGTACAAATTCATTAGATGCGATTGAGCATCTTTTCTTATTGGGAGAATTCAGTAATAGCGTAAAAAGTGTTCACAGAGCACTTTG
TATGATGTAACACAGCATAGTCCATCGAAAGCGCACGTCGCAACAATCTAGCAACTTTGACGTGGGTTGTAAAACGGTGCGCGCGCCAGCCGATTCACGG
CATCCTTGTCAAATGACTATACCAGACTACAACAATAGCAATAGTACACTCGTAGTACTCCGCGTAGACTCATTTTACGTACCCACATCGAACTTTCGTG
CTCATGCTCGCATTTTACTCCATCATCTTTTATATTACCAGCTACCGCATCAGCGCTGCAAGCCCCTCCAATCTTGGCATCGAGCTTATTTGACAATTCG
ACTCTATCAATGCGAGCGCGAGATTCGGTCCGTCAAAACCACGTCTGCTCCTTGATTAACACACCCACGGCGTTCCTGCAAGCAGCTCGCCACATTTACT
AGAATGCGTGCTGTGTGGCCTCTCTGTTTGTTAACCCAACACCCTATGACTTTGTAGACGCTTTATTTCGTAGCGAGCACCTCGTCTGACACCACGCAGG
ACGCGTGTGTTGTTACTGTAGACGAGATCAACTCAATGGTGTGTTATGTGCCTATTCTGCTGGTGGTCGAGCGCTTGAGCCTCCTACACTAACAGGTCTG
AGACATTTAGTTTCGACGGACTCCATGTCATTGTTTATGTTCGGCCAGTCGTTGAGACAGAAAGGACTGTATCACTTCACTTGTGCTGTGTCTAGAACCA
GCAGCTCCTGCTCCAGATGTTGTGCTCATAACCAGACGATCCAAAACATCCGACTCGGTTATATCCCACGGCTACATCAACTGCGCCGTAAGCGTTGAAG
AAAGTCACTACCACGAAGCCTGCCAGCTCCAGAAGCAGCTTGAAGTCAAGGAAAAGAGCGGGATAACATCAGGCTGTACGCAGAAAGAGCTTGTCCACTC
TAATGCTTACACGCCTTAGAACTTCAAGCATTGCAAGTTACAGTCTTGTAAAATCGATATCAACGACATAGGTGCAATACTGACGGTGTCTGCTTCACGG
TGATAAAGCACAGAGCGAATGCAGCAACGTGGTTGAACGGGACTGGCCGCTTAGTCGGATCCGTCCCACATCAGCTCCAGCGATCCCATCTTGTGGGAGT
TGCAGTAGTGGCAACTGCTAGAGACTTCCGTGTCACTATACTGTTCAGTCAATCCAACTGGTCGAGAGACAGCATTAGTAGCGAGCAGCATGACGAACAA
GAGATGAGGTCGATCGTCGATCCAAAGCGAGGTGACAATGAATGCTCTAACGTGAGAACAACTTTACTTAACTAGAGATCCACTACACACGGCCAAAAGG
CTGCACTTCTCAGACATTCTTCGTGAGCTCGAACTCAATCAGCTCGTCCAGTACGCTCATACTACAGCGGCTGACGTCCCCCACGGTCGGTTCCAATCCA
ACCATCCTCGGGTCCATATCCCGTGGCCTCGCCATCAAAACCTCGGACGGCGGTCCATCCATCGTGTGAAACGCCGTCATCTCGTCGTGGAACGACGACA
ACTCGACCGAGTCGGGTGAATATACTAGAGGGATCGGGAGCCCGAGTCTTTTCGAAAACTCAACGGTCGTCGTCAGATGAGGCGAAGGGATCCGAATGTG
ATGCGCAACGGGGCGATGATGATACGCGGGACGAGGGTGGCGGTGCATTGAGGGGGAAGGTTTTCGAACGAGCTCCGGGTGACGGGTTTTCACGTGACGC
GTGAGGTTCCCAGCTGTACTAAACGTCTTGGTGCAGCCCAATACACTGCACATGTGCGTCTGTCGTCCAGTGTGGATCTTCATATGGTGCTCGAGTTTCT
CCTGGTTTGGAAACGAGCGCTGGCAGCCATTGATGTCGCACTCGAAAGGCTTTAGAGACGCATGTAGACGTTTGTGCCGCGATAGGTTCCCCGACGTACT
AAAGCGTCGACCGCACTCGGGCAATGGACACACGTAGGGCTTTTCGCCCGTGTGGGTCTTCATGTGCTCACTGAGCGTGAACTTGCGGTTAAACCGACGT
CCGCAGCCAGGCTCGTCGCACACAAAAGGTCGATCCTTGACGGTTGACGTCGATGAAGTCTGTGAGGTGACGACGATGCTGTCATGGACATCGTAGAGGA
GGGTACTACTGGTCCGAGGCGACAGCGGTTGGGCGAGCAGTGACATCATGATGGCACAGGCAGAGTTGAACCCGTAAAGTAGGACGAAGTGCTAGAGTGT
GTGTGTGTATCTTGTCAGCTCCTGATGCTCCTGCGGCTAATCAAGAAATGATGAGCTCATCCGACCGGGCAGTGCTCGCTCGAGACCTGATGTGGGGGAG
TAGCAGACAGCTGGCGTCGTCGTCGTCGTCGCTGAAGTCGGGATGAAGACCGGGATGGGCACTGTGGTAATACCACTGACATGCAGACTAGTTGAGTCTG
GACCGGCCATTGCCACTGCAGGTGAAGTCGAGTGAACCGGATCTCTCGGGTGTGAAATGCGATCGCTGCGCTTGACAATGGGGAAATGGCTGGCGGAGCT
CGTGCAGTGGCGCTCTTTCGACTTCATCATCTCATAATGGCCAGCCATTTGGACTTGATTTGTAATGTTGACGGAGGTTGATTCATTGGCACATGATTAG
ATGGTGGACTACAGGTAGGGGACCCTGGTAGCATATCTAATCTCAGTGGAGCGACGCTTACTAATGCAGAAGCAGGTATTTACAGGTATGCATTTAATGT
GAAGGAACAGCTCATTCGAAACTGATCGAGGGTGTGCGATAGACGACCAGTAGTATCCCTACAAAAAGGAAGCTTGAGACGCAGTCACCATGTATAAATA
AGATAGGGGAGCAAGCTCTGGAGCTTGCTCGTCCTTTGATATAAGTAATCCAGCTGATAGAACTGAATCAAGTTGAAAAACACTATGCAACAGCAGCAGT
CACTGAAGGAGGAGTATGATGATGTTATTGTCTAAATTAATCCAGAAGTTTTGTCATGCAACGCGATCAGCCTTTGCTTGTGAGCGTCCAGTGTTTGCTT
ACATGATAATATTCAACTCTGATCGATTTTAAACCAATCACGTGCGTGCATCACACTAGTGACCTAGCCAAAGAGTGACTTTGAATATACCTATACCTAT
GAGGGGGGACAGGCTAGATCGCACTTAATACGTGTAAGGTACACCTGACCGCGTTATTTGGAGACACTCACAGACACACACACACACACAGATAAGTATG
ATTTAAAAGTTCGGCATTCAACCTTAAGCACACTCACTAATAGCTTCACCCTTCGGGCTCACAGTTATGTGCACATATGCTTTGTGGTAAGCTGACGCTT
GATGTAAAAGTTGAGCTCTGGGATGACCAATTAGTTGAGCATGCATTGACAAGCGGCGTTGTGACTCTAGCTCTAAGGCTGAGTCTTTTATGGCCAGCCA
GACCGACACTTTTCTCTCGTCCTGGATTCCCTGGCAATGGCGGCTGTCAGGTTTCTACGCTGTCAGTCCTCTACATGCTCTGGACGCAAAGAAACTGGAA
GTCTTGATTGCAACAGTTTCGTGATATCCCGAGATTTGCTTCCTAAAAAGCAGGAGGAAAGTATTGAAAGTACAGAGCTCTGCACAGAGGGATCCTGCCA
CTGCAAAACCTGCGACTGCTCGTGAAGTTCTCAATATAATGATACTGGTCCATCATGATTGAGAGCTAGATAGATCTTGTGCGCGGACGTGTTGCATACA
CCACCGGTAAAGAACGTCTTTCCAACTGTCAACGTCGATCAGGGGCTTGCTCACGAGGAGACTCCATTCCTTTGCCTCGCGCAGGTGATCTATATAGAGA
CAACGAGCTCAAGGATATTCGCACACAGTTTGACTTATATGAGATATCGCGTATGGGTGCAACAAAGCCTGAGTCAGATTGGTC