Description :
From Genome Similarity Track
Location :
Scaffold_21:901755- 903089
Transcript NameFunction/comments
Phypa_INRA-310PPTG_09938hypothetical protein

Sequence
1334 bases(100 bases per row)
TACTCAGCCTATGGCTATCATGGACATTTCTTCTGCCTCTCTCCGTCAAAACGGGATGTTATTCTGCTGCATGAAGGCCAAAAGCATTTGTCGCTCGTTC
GGCGGCAGCATATCCAGTTTTTGCGGGGTCATATCGCGCGCGAGTTCGGCGATGGCATCGAATTGTCCAGAGGGTGCAGCTTCGCTGGGTTTGGCTCGCT
TCGATGGGTCGTTCTCTCCAGGTGTCGGCATCAGTCCTGGTTGTTCATTGGGATACGGTCTCTTCGCCAAACGTGGGTCTCTTCCTGCACGTCTCGGATC
CCGATTCGCATGCGCCAAATTACTACTGGGGGGACCACTAGGCTGAGGTGCGCCTGGTGGTGTGGGCATTAAACCTGGCTGTGGTTGGGCGTGCATTGGG
CTCGTAGAAGGGATACCAACTCCTGGTCTATTAGCCATAGCAGCACTAGCCCCCTGAGTGGCCAAAGGTCCAGGACGAGCACTCCAACGAGTACCACCAG
ACTTGGTTGGTGCTGAAGCAGGATGAGGAGCCATCATAGCGGGTTGGACACCGGGAGGTGCCAAGCCCAGAATGCCAGGCCCAGGCCCCATGGGTCCACT
CATCGGTGGACGTGGAGGAGGCGGTATCATCCTTCCAGCCATCGGTGGAGGCTGGTGCATCATAGGAGGAGGAGCCAGCAGCACTGGCTGAGTCTCGGTG
GACGACGGAATGGGGATCTGAAGCGTCTTGAAACTCTGGACGATAGCGTGAGTGAGTGCTGGGTTCGCCATCAAGATGCTCTTGGTCACTTCCGGTTTCT
GTCTTGCATGTTCTTTGAGTTGCACTAACATGTCGTAGAGTTTGACAGGTCCCAAACGAGCTATCGCCGACTCGATGGAATGGATCGCCATTTCCCCCGT
CACCATCGTCGGAGGGCCCCCATCCGCTCCGTTTCTGAAGTTTCCTCCGCCAGAACCTGGACGTGTGTTGCCGCCATTGTCGTGTCGTTTCCTCTCTGCA
CTGTTGGATTTATCCCCGCCGTCGGCAAAGTCCACGCGGAGATTCCGGCCGTTGATCTCGTATCCGTTGAGGTTGCGCATGGCACTCAGAGCCGTCGCTC
CGTCCGCATACTCACAGAAGCCATAGCCCTTGGGTTTGCCGGTCTCTCGGTCTGTCACAAGCCTGTAATAGCATAAAAATTAATATTTACATGGCTTGAG
CTCCGACCACGATATTTGCAGCAATTCTAAGGTGTTTTTGGCAGCTTACGAACCGAAAATTCATGACTGAGCCTGCCTCCGAGAAGATTTCCTTGAGCAT
GTCCTCCGTCACATCGTATGGGATGTTTCCGACT