Description :
From Genome Similarity Track
Location :
Scaffold_4:901640- 909786
Transcript NameFunction/comments
Physo_352705conserved unknown protein
Physo_445582Hypothetical protein
Physo_247908Hypothetical protein

Sequence
8146 bases(100 bases per row)
CCAGCGCCATGCCAGCGTAGAGCGGCAGCTGGAACAGCAGCATGCAGCAGACACTCTCGCAGCCTCTGGCCACGGCGCAGCTCAGCAGCGCCGTGAGCGT
GAAGAAGCAGCCCAGGCTGAAGCTGATGCGGTAGACCAACTGGTTGCCCATGCATGTGCTCGGGTACGCCGAGTCGTCGCACTCGTCGAAGACGCCGAGC
CTCGACAGCACGTCTGCAGCAACAGAGCAGGCGGGCAGGTGTCAGCCACACTCGAACAGGTATACAAGAGCAGATGGACGATGTATACTCTGGCCGAAGG
TGCGCAGCAGGCCTGCGGCCGCAGCGCTCACGAAGAAGAGCGCGACGTAGCCGACTCGGGCCATGATGGTTGTTGGAAGAGTTCTGAAAAATGAGTAGCG
TATCAAAGTCTCGGTTTTGATTAAGTATACAATGATTTTGCGTTTTACACTGCAAAGGGTATTGTGAGTCCATTTCGACTAAGTAGCACTTCAACTTCGC
TGCCTGTCACTGGTAGAGCTGCATCTGCGTGGGCGGCACGATGAGGTCCTCGTTGATGGGGGCGGCCAGGTACTGCTTGAGCAGGTTCTTGAGCTCTGCG
TTCTGGGTTTTCATGGCCGTCACCTCGTCGATCAGCTCCTTGCGACGCAGCAGCGCCGTGTTGTAGTGCGTCAGCCCCTTCTCGAGCGTGGCCATAACGC
GGATCTTCTGCGCCGGGAACACCTTGACGATGTTGGTCCAGTATTCCTTCTCCGCCCTTCCGGGCCCTGGCCTTGAGCGCAGCCGAGCTGGTGCCTTTTG
TCGCCTTCTTGCCGCCCTCCGTGTCGCCGCTGACTGAGCGGTGCAGGATCCGAGCAACAGGAGCAGCCCGCTTCTGCGCATTCGTCTCCTGTAAATGTAC
GCAAGCCCAAACGATTAGTTCAACACAGAGCAGAGCAGATAGCAGCAATGTTCACGGCGACGGACCTCAACGAACTGCTTGATGACTCGGATGACGTCCT
CCGGGCCGACGACAAGGCCCCACGATGACTTGGCCCCGTCCTTGCCGGGTGAACTGCCCTCCCGGTTGTTGTCGCCGCCAACAGGAACCTCCTGTCGCGG
ATCCTCGAAGAAGTAGCCCATGAGCTTCTCCATGTCCTCCTCGTTGTCGATCCCGAGCGCGCGCATGATCATGTCCGCCTTCACAAGCTCCGCCTCGTCA
TCCGGTAAATTTTCCAGCGCTTGCTGCACGCTGCCGTTCACCAGGAACCCAGCCTCGGACGCGAGCATCTTCAGCATGTACTTCAGCTTCGCGCCCGATA
TTTTCTTGACTGGAGGCGTGTAGGCCTCGACCGATTCGTCGTCGAAATCGTCCTGGTCGGCGTTCAAATTGTCGTCTCGCCTGCTGCCGCCCTTGTCGCT
CTCGTTGGAATCGGGCGACGACTCGTCTCCGTTCTCGAGCTGCTTCTGGAGAGCTGCCACATCACCAGCCTTTGCAGACTGACTCCAGTTACGGATGGAC
TGCGCCGGTGGCCGCCACGTGAGACCAAGCTGCTGCTCGTGGATGATGCGATCTGCGTCCAGCAGCTTTTCGATCTTATGAATCGCGTCTTCTTCGTGCA
TCTGCCACACCTCGTCGAACTTGTTGCTGTCGCTGGATTCGAAGTGCGCGTACTTCCTCTGCAGATCGCGGTACTGCTTCGTGAGGCGCCGATATTCCTC
CGTGAGCTCCTCGTTTTGGTGTCGATCTCGGGCGTCAGTCTGGTTGTACTTGGCGATCAGAGTGGCCAGCGCGTCTTTCAGTCGAGCCAACTTCCGCTTC
TGCTGACTGAGCGTCGCCGAGTTCTCCATATCGCGCTCCGTCAGTACTCGGTAGTTGTATTCGAGCTTCTCTGTGTTGAGCTGGTACGTGGCGCGCATCT
CTTCAAGCTGCTGCTCGAGCGTCTGGATGTTGGTCTCGAGCTTAATCTTGAGCTCGTTGTAGTCCTCTGCATCGCGCACTCGTAGCTCCTCGATCTCCTG
CAGATACTGCTCGTCGCGCGTCTGCTTGGTCTCCATGTAGACCATCTCCATCTCGCGCCTGCGCTCGAACAGCGAGTCGATCTCGAGCTTGTTGTTGGCG
ATGAGCTCGTCTCGCTCCTTGAGGAAGGCGTCTTCCATCTGCTCGAGCTCGAGCTCGTACTCGTCCTGCATCTCGCGGTACTGCTGGCTCATCCGGTCCA
CGAGCTTCTCCACCTCTTCCGCTTGAACCTTGAGCGCCGTCACGTACTCTTCGTCCTTGGCCTTGAGCTGGTTCTGGAACTCGCGGATCACCGCGTCCTT
GGACGCCAAGATCTCGGCGCACGCCCGGTTCTGCAGCTCCAGCTCGTTGTGCAGCTCCTGCGGCATGCTGAACTCGAAGAGATCGGCCCAGCGCATCTCC
ACGGCGGCGTTCTTGGCGCCGCTGTCGATGGCCTCCTGCTGGAGCTTCTGCACGCGCCGGTGGCGCCGCTCCTCCTCCTCGACGCGGCGGCGGTTCTCGG
CGTCGTCCGCCTCCACGCGCACGCTCGTGACGTGGCGGATGCCCGCGAGCTTGCGGCAGTCCAGCTGGTTGAGGCTGTCGGCCACCTGCTGCTGGCCGCG
GCTCATGCGCTGCGACTCGCCCACCTGCAGCTGCTTCTTGCGCGAGGCGTCATCCTTGGACGCGTTGCGTGCCTCGATGCGCTGGCGCCGCACGTTCATG
CGCGCCTCGCGGTCGCTCGCCTCGGTCGCCGGGTCCGCGTGCGCCTTGGATGAGGACGCGGACGTCGAGTCCATCGTCATGGCGGCCGCGCGATGGTAGT
TTATCAGCAGCGCGGCGGTTGCAACAACGGCAACAAGACCATCACTTCAACATGAGATAATTCATGATGTCAGGTTTATCGTCCACGATAGGATATGCAT
TTACATGAGTTTATTGTGATCATAAACTCAACACATTTTCCAGCCCAGCATGGACGAGCAGGCCGCCACTACCGCCACCGCCGCCGCCGCGCCGCCGAGG
GCCCAGGCGACCAAGAATGGGCAGCAGATGCTGGCGCACTTGCTATCCATCGCGTACCACGTGCTGGACGAGACCAAGCACATGAACCTGAAGCCGCCGC
TGCGCCCGAGCTCCAAGCTGTTCGCCGCCGACGCGCCCAGCTCGCCGCCGCGTTCTCCCGCTGAGGCCGACGCGCCGCAGGACGAGGCGCTGCCGGACGT
CAACGGGCTTGCTGCGGGATTTGCCGGCAGCCACGCGCACGCAGGCGGCGCCCAGGGCCACCCCATCGTGATCCCGTACTCGCCCGAGGAGATCCAAGAC
ACGTACTCGAAGATTGCGGCGCTCAAAGCCCAGTACATCAAGATCAGCGCCGAGCTGCTGGAGGCCGTGAAGGAGGTGGAGAAGAAGCAGGAGCCGCAGC
AGGACGACAAGGTACAAAAAGGGTTGCATGTTGTGTGGAGTGGGAGGGTCTGACCTGACGTAACCTGTTGCTGTTGGTGGTGGTGCCACAGGACGCGACG
GCGAAGCTCGTGCAAAGGAGGAATCAGCTGCGCAAGGTGCGGACACGCTATTATCGGTGTGTGGAAATTATGGTGGCTATGGGTTCTGATGCTTCTTGTG
CTGTTGTGGTGAGCAGGAGGTTTATGAGAGGAACTTGGTCATGAAGGGGCTGATCGACCGGCTGCGTAACCTGCAGCACTCGATCAGGCTGATGAAGGGA
GGGAGCGCGTACCCGCCTAACATCGTCATGGAGAGCGTCTAGATTCGTAGCGTCTGCTGCTGTGAATGATTTTCTTCTTCAAGTTAAAGTTTTTCGCGCA
GAACTCAGCTCTGACCGCAGCACAGTATGTATTGCTACAAGGTTCTACTTGCATTTCGTCGGCAAATGCACGTTCAGCCGTACACGGCAGGCTGCCGCTT
GCCGGTAATCTCTAACTTGGTTAGCTCGCGCTGCAGTGACTGCTGAGAACTTCTCAGCTCCTGGGCGTACGCTACGAGCTGTGTCACGGCGTGTTGTAAT
ACGCCGTTGTCATGCTCGAGGCCTTCTGCACGCGTTTGGGACTCCAACGCCGAGCTTTGGCAAGAATCCAAGCAGCTTTCCAGCTCGTTGCATTGCTGTA
ACAGACTGCATCATTGTCAACAAAGCAGAAGTGAGTGAATCGGTACACCAAGCATAGCAAAAGGATGCAGCGTACTCCGTGCGTTGGCAGCGCTCGATCA
CCAAGTCACGCTTGAGATTCCAGTTCGCTGACATCGCCTGCTCCTTTCGCTTCTCACTGCTACGGAAAGCGCTCACCACGGATTGAAGCTGATCCGTGCA
AAGTGTTAGTCAGATTGTGCTCCTCTGGGTTTCGCTTCAATTTACAGGTAGCTCTCGTACCTGTTTTCTGGCAGCAACTACTCCAGCTTGCAGCTCTCTA
TTGCGTTTGCCATATTCTCGCAATGCTCGCCCTAGTGAAACTTCGCTAAAGAGCAGAATAAACCAAGGTGTTAGTCACAAATTCATCAGCAATCGGTGAT
CTAGGTGCACTAACCGACTGCGACTCGCCACCATTTGCTTGCTTATCCCCTCCAGCTCGAAGCAGAACCTTGTTAGCGTGTCTTGGAGAAGTGCCAGTCG
CTTCTTGGTCGGAATGAGCACTGAAACAAGCTCGCGCTCGGATAGTTCTATCGCTTGGGCGTGCCGGCTCAGTACACGGTAAGCATGAGCAAGCTCCGCA
TACTTTTGACCACGTTTCAGTAGCATTTGATCTCGTCCTGCGAGCTTGAGCTTCATCTGAAGCATGTCTTCGGCGAGCAGCTGCGACGTCTCGGACAATT
CTCGTACCTGTTCGTCGAGTTTGTGACTCCTTGCTTGCTCGCACTGCAGCTGATACTGCAGCGAAATGTTGTTCTTCAATAAGTGCTGAGCATGCATTTG
ATCTTCAGCACGCTCAACGGCAGAAGCTCGCTGTGCGAGAGCCTGCTCCTCTTCGAGGCGCTGGATGTACTGGTTCTGCTGCTCAATTGTTCCAGCTTGT
TGCTCCAACTGCACGGTCTGCTGCTGGACGGTAGATTCTAGCTCATTGACACGCTGCTGCAGTGTCTGTCTCTGTTTGCCGAGTTCGCTCCACTCGGAAT
CGTGTTGTCGTTTCGCAGTCAACTCTTGCTGAATGGCCTCAAGTTTGCTCTTCAGAGCGTTCTTTTCGCTCTGAAGCGCTCGGACTTCCGCTGTCTGTCG
AGACGCTTCCAGTTGAGCTCGGTTAAGCTCCTTCTGAAGCTCCTCTTTGGCAGCTTCAGCTGCTTGCAACGCATTGCTGCGCACACGGATCTGCCCCTGC
AGCTCGGCTTCAAGCTCTTTCCCCTGGCTCAACTCCGCTTTCACACCGTCGTTCTGGATGAGAGCCTGCGCGGCCTTTTCGACCGCATTGTCCACTGCCT
CCTGCGAGACAGCGAGCTTTTGTGTGAATAGCGCGCGCTGCGTCTCCATCTCCGCCCGCGCATTCGCCACGGCGTCTCGGAGACGCGCCGCCGTCTTTTG
TCCCTCGCTGCACTGCGCGCGCGCCTTCTGGAGCCTGGCGTCTTTCCGGGCCAGCGCCGCTCGCAAGCGCTCCATCTTCTCGCAGATCTGAGCGTACCGC
TTGCTGTCCATGGGCAGGGTGTCCCTCGTGGACAGGACGGAGAAGGCCAGCGACGACACGCTGCTCGCGATGCTGGCGTCGCTGCCGCGTCTCGACGCAG
AGCAGCGCAGCGGCGACAGAGCGCCCTCGTGGCCCGAGGCTGCGGCTGCCTCCAGCTCCTGCCGCAGTAGCTCGATCTCCTGCTGCTGGCGCTCGATGAC
GCTGAGCCACTCGGCCCCGAGCTCCTGCTGCCCGTCCGGCGGCATCATGGCTAACGTTAGTGTTGCCGTGGCTCCTCGCGCTTCAACATGGCGGTTATTG
GCTGAAAAGCGGTTGCAAGACAATCTATTTTGTCCAATGACATCATCATCAGACGCCCAACATTCGCGAAGAAGCGGAGGGTTGGCGACGTGTACGAGCA
GGAGGAGCCGGCGGTGGACGCGCAGCAGGCGGCGGGGGCGCCGTCCGCGGCCGGCATCGTGGCAGAGGACGACGACGACGACGAGATCCTCGCGCTGGCC
GGCAACCCGGACGACCTGGACTCGCAGCATCAGCAGTCGCCGCAGCAGCAGCACCAGGAGTACACCAACCAGCAGCGATGAACCCTGCTGGCGTGAACGC
TCTTGCTCCTTCTTCTGCTCGAGCTGCAAGAGTTCCTCGTCTCCGTCGATGTCGCGCTCGATGTCCACGGGACGCTTGGCATCCTCCTCCTGGAGGATGT
AGACACTCCTGCTCGACCTTGAGGGCCGCTTGGCACTCCATTAGCCGCCGCCGACATGGGCTTCTTCTCGTCGTCCTTCTTGGCGTCGGCATTGGGTTTT
TCTTGCCCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTGCCGTCCTTCTTCTCGCCTCTAGCAGCGGGGGCCAGGTACGCGGC
GGAGGCGGCTGGCGGTTTGTTCTCCGTATTGTTGCTCGCCTCCACCTGCAGCTACTGCTCCTGCATGTTGGCGCCCTCGTTGGGCGCGAGCTCGTTCAAC
AAGTCATCAAGGTCGTCCAAGGCGAAGGCCGCTTCTGGCTCTGAGGCTGAGGCCAAGACAAAAGCTGATCCGAGTAAACCAGGTGCAATTTCAATCAGAA
CAGAACCTGGTAGCGCAGTGGAGCTGTGCCTTCAAGCCTGACCGAATATCGAGACACTCGGAGCAAGTGGTGTTGTCTCGCATCCAGAGGTTGGCCGACA
CTTCCTCGCAGAAGAGCTCCACGAACGCCAAGAAGGCGAGCGCGACGAGCTGGAAGAAGCCGTCGTCCCGCTCAAAGAGCTGGCGGTGGCTACCGTCAGG
ACAGCTCGGGCACTCAAGGAGGCTCAGGCGGACGGACGATCGGACCGATACCGTCCGTACTAAGCACCCGCGACACGAGAAAGCGAAGGCAGAGAACCGA
TTCGAGCCGCGCAACCGCAAAATGGACGTGCGCGCGATCCGGCACACTTTGTTCCCACCCCAGCTACGATGTGCTGGTTTCCCCTCCCCCGACTTCCTCG
GCTCGCCTTCTCCAGCTCGTACCTGTTGCTATGAAATCGATACTTTTTTCACCCTGCCGCCGTGTTATTCGTACTACTCGCTGTCGCTACTGAACGCCGT
GTTTCGGGATCATCTGTAGTCGTCATTTGCTAACCAACTAATTAACCGCAACTCGTGCAACGACAACGTTGACACCGCGAGGTCTGACATTGCTCGAGTA
AGCTCGGTTCTTCGATCGGTGCTCGGGTTCGACAGCACTGAAGTTGAAGTAGCATCAACAACAGACCGGCCGTCGAGACCCTTGAATCGAAACTGCAGTA
CTGCAACGAGCTCTTCTGGAGTGCCCACCGATCTGAGAGACTCCGAGACTCGAGATTGGCTTCGGAGCTGCTGGAGTATATCCGCGAAGTTTTCCATGTG
AGGACCCGTTAGCACCTGGCACCTGCAAGCACATCCGTCAGCCACTAGGTTTGGAATGCAAGCTGAAACTCGCTATTGACCAGCACACGCACCCCGCTCG
CAACGGCTCGATTGGGTTGTGACCGCCTCGCTCCACAAAAGTTCCTGCGAGAAGATTCAATGAGTGCTAAAGGCACAAGCACAAAGCAATCCGCTCAAGC
TCTTGAGTCCCTACCTCCAATAACTGCAGTTGAAATCGCGTCGTAAAGCAAGTTTGTTTCGCCCTGTAATGGATATCACACATCGAAGAGATCGTGAATC
GGGGCGGTACTTCACGCTACGGCAGCCAACACGTCAATCTGCTTACCATCGTATCCACAAAGAAAAGATCGACCGAGTTCGAGGGAAGTCCATCGCGCGA
GCGCACACCGACCAAAAGCTCGGGGAACTAAGAGGGCCACATCAACATTTCTTAGACCGGTTCAAGTTTCTAACAGCTCATGGATACGCAAGGATATACC
TGGTTCTGAAGCTGCTTCACGATGGCAGGTGTCCGCGTAGGATGCCGCGGAATAATGACCGTAAGGAGGTGCTGGTCGTGGTCTAGACGCTTCGAGAGAG
CTGCGTGAACTCCAGCCATCATCATCTCCTCGCCGTCGTGAGTACT