Description :
From Genome Similarity Track
Location :
scaffold_1:901534- 903757
Sequence
2223 bases(100 bases per row)
GTTCGACATGAAATCGATCGTGAACCTGGTTCAAAGCATACAGTGCTTCtacagtggccactgtcgcgTGAAGTTCGTTAGTATATTGATGGGTTCTTTG
CTCAACAGCCATCTGCTGGTTTGGTGAGGAAAGCCAGTCCCCTCACAACGCGCCGACTTTTAGTGTGCGCAAACCAAATGGGAGAAGCTGCATTGATCAC
GCCTACAACAAGTTAAATGCGCGACAATTTCCGCTCAAACGCCGGTTTCACTAAAGAATGTGATCAACCACCGTATGTCCGGCTGTACACAAAAATTGGA
TTTGGTTCACTAATGAGGATGATGTCTCGTTGACTGCTGTTAATACACCATCCAATATGTTATGAGAGTGGCTTGTGATACCACAAGGACTATTCAATGT
CCTAGCAACGTTCGATCGATTGGTTTCCCATCTGTTTCGGTTACTGCGACGCTTTGCACAAACTTATTTTACCCacatttttgctttttcgAAAAACGAA
GATGGTCGATCTGCCATAAAGTGCACTTGGAGCACCTCCGTATGGAGTTGAAATGTATGTGTGAAAATTCATAGCCAGCGAATCTTGCTTTTGGTGAATG
AAGTACCGGAACTTGGTTGTTTTGTCGGTGAACGCAGCGATCGTGCAGACCCAGAGAAGGTCAAAGCAACTGTGCAGTAGCCGACGCCTCGGAATCAAAA
AGAATTGATGAAGTTGAAGCGTTTTTTTCAGCTACCTGCATCGTTTCTCGCGTAACTACGCGGACATGGTTCACCCGCTATCAAACTTGGTGAGGAAGGA
CGTACCATTCGAGTGGTCATCCACTGCGAAGAAGTATTCACTCAGATCACGGACAGCTTACTTGCTATACCAGATGAAACGATGTCGTATAGCGTGGTGT
GTGATGcttctgagtttgcaatcggtTGTGCACTCTTGCAAAAGAACTAAGATATACACGATCATGTCGTGTCATTAcaatcgcgacagctgaagcAAGC
AGAAAACAACTACCTTGTCCGTGGCTGGAAGctttttgcaataaattaTACTGTGGTGAAGACCCACGTCCACCTCATGGGTTTAAGTCTGCTTGCCGTC
TCCCTGGATCACACAAACTTACGTTATGCAGTTCATCCCCCTCACTTATCACAGCGGGTTGCTCGCTAgttgtcattctttgcagactaCAACTTCACGG
TTGTGTATAAACCGGGAAATTTGAACGTGCCGGCTGACGCGTCGAAAAGTCAACCAAATTATAAGCTAGCGGATATTAGCTATATTGAAAACGATGTATT
CGATATGATACTACGAGCGTCTGTTAGATAGACAGTGCGAACCGAACATCGAGGCACTCTCACTAAGTGACATGGAGCTCCATGACAAGCTTCCTGATCG
CTTGAAATCAAGGATACATTGTTATGCATGAAAGGAAGGTCTATTTCACTATGAAGTTGCACAAATGGTATCAAGCCAGACTAAAGGGATGTGGTCTTAA
AGAAGCTGGTGTCGTACGGATTGTGGCTCCACGGAACGATGCGTTGAAGCACAAGGTTTGTACGAGGCGCATGATACGACGATTACCGGTCACTTTGGCC
GTGATAAGACCTACCAATCCCCCCCAATGTGTGACGCTGCATGTTCAAGTGGGTTGCACGATTGCGATGTCTGTCAGCAAGAGAAAGGCACACGGCACAC
GCAAGTGCCAATGCAGAGTCTCCCAGTTCCTACTGATTGTTGGAAGTCAGGCGGTCTCGACTGTATCGTTGGCTTTCCCGAAAATGATGAGGGTCACAAC
GAAGTGCTCGTCTTCGTTGATAGTCTCAGTAAGATGGTTCGCATGGCTTCGTGTAACTATTCCGTTGCTTCGGCTAAATTATTCTTTGTTGCCATACGCC
ATCGCATCTGTTTGTGTACACTATTCACGAGTTGCCTTGGACAGAATTGTCTCGAACGCTTGGCATACGCTAGGATATGTCACAGCGGTACACCCGGAGA
CCGATTGGTAAACAGAACGTGCCAACCGAGTGGTCGGTGATGTGTTGCGAAGCTTCTACGCGGATAATCCTGCAGAACGGAATTCGTTGCTACCACTGAT
AGAGCTTGCTATAAATCATCCGCTGGAAATAAGCCATTTTTATAAATGACTTGCGACACCCGCAAGTACCACTATGTGCGATGTGTGGTGTCTCTGGCGT
TAGTGGGAAGGAGCTCGGCAAAT