Description :
From Genome Similarity Track
Location :
Scaffold_24:90152- 93869
Transcript NameFunction/comments
Phyke_g1572histone acetyltransferase, putative
Phyke_g1573hypothetical protein PHYSODRAFT_327098

Sequence
3717 bases(100 bases per row)
CGTCTCACGTTGATTCATTGATCACGTACTACAACGCGACGGTGTCTCCAGCGaatctgaagaagaaactggaggtAATTCTGAAAGGCATGATGGAGCA
TAAATTTGGGTGGGTGTTCAACACGCCTGTGGATCCTGTGGCATTTAATATTCCGAATTACTTCAAGATTGTACGCAAACCCATGGATCTGGGGAcagtc
aagaagaaactTGAGATTGGTATCTACAAGCACATGGAAGAGTTCGCGGTCGATGTGCGCACAACGTTCCAAAATGCTATGCAGTACAACAGCGAAGACC
AGGACGTGTACAGCCTCGCGAAAGACATGCTAGGTGATTTTAATGGTGAGGTGCGCAAACTTGCGGCTGAAATAGCTGTTGATGAGAAAGCAGCGCGTGC
GAAGGAGAGCTCGTGTCGGTTGTGTGGCATTGAGCGCATGGTATTCGAGCCTGCTGTGCTGTATTGCAACGGCGAGTGCAATAGTCGTATCCGCCGGAAC
TGCTACTATTATACCTCAGCAGACAACAAATATCATTGCTGCCATCCATGCCACGCGAACTTACCCGAGGTTATCAAGCATAACGAAGGTCGTCAGTATC
GGAAGAATGAACTCTCTCGCAAGAAGAACGATGAAGTGCATGAAGAGCCGTGGGTGCAGTGCGATAAGTGTGAGCGCTGGGTGCACCAGATCTGCGCACT
CTTCAATGGCAAGATCGACAGCGAAAAAAAGCCCCAGTTAGTTAAGACCGAAGGTGGTCCATCAGCCGATAATGATGATGtgccttcgtcatctccatca
gctACAAACTCCACGACCACGACTACTACCACTACGGTTGTCGCTAAGAGCTCAAAGTCGTCAGGATCGTCAGGGTCGAAGGGTACAGCGTCAATGCTCC
ATTCAATTACCACATCTCCCGGCAGTGAATTCCTGTGCCCAGATTGCTTGTTGGAATACCGCAAGCGCGAGCCCCAAAAGTATAAAGTGGGTCGACACGC
ATTCAGTGCGAAAGACCTGCCACGCACAAAGCTGTCAGATTATCTGGAACGCCGTATCGTTAAGTCGTTGCAAGCTGAACGTGAAGACGAGGCAAAATGG
ACACAGCGTGATGTAAAAGATGTTGAGACCGCAGAGGGACTCACTGTGCGTTTGGTGTCAAATATcgagaagcagttgatggTACGCGATAAGATGTTCC
AGCGGTACAAGGACTCGCACAAGTACACATCAGAACACCGCTTTAAGTCGAAGTGCATCTGTATGTTTCAGGAGCTGGACGGTGTGTCTGTGTTGCTATT
CGGCATGTACGTGCACGAGTTtgacgaacaagaagcgGATTGCAACTCGCGGCGCGTGTACATTTCATATTTGGATTCGGTGAACTACTTCAAACCGGCT
CACCTTCGCACGAAGGTGTACCACGAGCTGTTGATCGCATACTTTGACTTCGTGAAGCAACGCGGCTTTCACACGGCGCATTTGTGGGCATGCCCACCTC
TTAAGGGAGATGATTACATCCTGTACTGTCACCCTGAAGCGCAGAAAACGCCAAAATCTGATCGGTTGCGCGCCTGGTACGTAGACATGCTGGTGAAGGC
TGAGGAGGAGGGAGTAGTGTGGCAGATCACCAATATGTATGACGACTACTGGCGAAACGATAATACGCCTTGTGTACTACCATACTGTGAGGGCGATTAC
TGGGTAGGTCTGGTCGAAGACTTGATCGAGAAATTGGACGCTGAAAAGCCGAAAAAGATCGTAAACAAGCGTGGTTCCAAGTCGCAAAAGCGCAAGAATT
CGGACACCAAAAAGACGGCGAACAAGAAATCCAAATCTAAGAAGCCGAAGCGCCGAAAGACTGGGTCTGTAGGTGGAGAAGGATCGggtgacgaagatga
cgacgagggCGACACTCATGAAGAAATCCCCTCAAGCTCGACGAATCGTACACTTACGGTTAAGTCACTGGACACGCCTGACCGGAAGTTAGCAGACCCG
TTGATGCACAAATTGGGTGAAGTGTTAGAGCCCATGAAGGACGATTTTCTGGTGGTGAAATTAGTGCCGTGCTGTCGCGTGTGCAACACATCAGTAGTGC
AAGGAACGCTGTGGCGCGACCCGAACGTGAAAACAGAGCATGGACTGAATCCGAAGGTGGTGCAAACTGCATTGTGTGATGGATGctacaagaagctgca
ggtggtggcggcggcagGATCATCAGCAGCTCACAATAGGCTACAGACGCGGCTCCAAGCCCTCACGAAAGAAACTGTTGCCATGCCGGAGCGTTGCACA
GACCCAGACGAGGTGAACGATAGCGAATTTTTCGACACACGGCAAGCGTTTCTGAGTCTGTGTCAGGGCAACCACTACCAATTCGACGAGCTGCGGCGCG
CGAAACATTCGTCCATGATGGCTCTGTACCATTTGGGCAACCCGAATCCGAATGCTTACATATACGAGTGCAACGCGTGCACGCGTGACATTGTGACAGG
TAATCGCTGGCATTGTCATACGTGCCCGGACTTCGACGTGTGCGATGCTTGCTATGCAAAAGAAAAGCACGAACATCCGTTGGAGATGGTGCCTACAAGT
GGCGCAGGgactgctggtgctgctggtgcctCTGCTGGCCCgggaggagctgctggtgctggtggtgcccTTACACAGGAGCAGCGCCGTATTCGCGAGC
AACGGGCGAAGAATGTTCGTTTGCACATGCAGTTGCTTGTTCACTCAAGTTCATGCGCTGACGGCAACTGCGGCTCGTCCAACTGtgagaagatgaagga
aTTAATGCGCCACGGAGCACAGTGCAAACAGCGTGCATACGGTGGCTGCACCATTTGTCGGCGTGTATGGGCGTTACTCCAGTTGCACGCTCGCCAGTGT
CGCCAGTATGAGTGCAAGGTGCCGCGGTGTCACGATTTGCGTGAACATGTTCGGaaattgcaactgcagcagcagctcatggatGACCGGCGTCGCGCCG
CGGTCACGCAACAGTATCGTCAAATGCAGAATGAGCGTCAACAGGAACAGAATCAAGCGCAAGGCGTCGATGATCCGATGCAGGGATGACAAATGACAAA
CAACCAGCTAGCCTAGAACCAATGTCAAGTGTAGCATAAAGTAACATGCCCCTATTTGTCCCGTACCTGTCGTGTTACTCATGACCATAGCAAGTAAGGA
CCTTAAGTCAAATAGCAAAGTGAAGCTGACATGATTGACAAAAAGCAAATAACGAGGATCAATTCGTCCAGTACCATTAACCGCTCAAGGAGGTCTGTCT
AGTATAGATTGTATAATCTCTTGAGGCAACGGATACGGCCCTTGGTCACTCGTCTTCGCTTCAACACTTGATGTCATCTATGCCGCCTTCTTGCCCAGTC
GTTTCTGACGGCGACGGTGGTGCGAGCACGGGCGTTTGCCGTGGTTCGCCTGCAATTGAAAGCAATAAtaacagcaaaaacaaagCAGTTAGCATCAGCA
CAACTGCAGACAAAAAAGCTTGCTGCAATTACCTTCTTGGGGCGGCGAGCGTTCCggttcagcagctccatagCCACAGGAGTCTCCTCAACAGCGAGCC
AATTAGTTGCAGGCACACTGCGGACGTTTGCCACAGCGAAAGCAGGCTGACGGGCTGTTAGTGGGATAGATTGACACGCAATGTTAGTTAAATTGTGTTT
ATAAATGACTTAAAGAA