Description :
From Genome Similarity Track
Location :
Scaffold_84:90143- 97521
Transcript NameFunction/comments
Phyra_83198DNA polymerase epsilon subunit, putative
Phyra_83199DNA polymerase epsilon subunit putative
Phyra_83200predicted protein

Sequence
7378 bases(100 bases per row)
TATTCGACGCGGCTGAACTCCGTGGTGTTGGTGCTCGGGCGGTAAAACACGAACGAGAAGTCTGCATGGAACGGACCCGGGTGGAAGACGCCCACGGACG
AATAGCCGAGCTGGTATTGCTCAGTCGAGTCTCCAAGGATAAGCACATCCGGGGTCGGGAAGAGTTGCAGCGACGAGTCGAAGTCCCAGTTGATCGGGTT
CGCCATTAGCGGCAGTGGACACAAATGCGCCTGGTCGATGAGCGTTTTGGCCAACTGGAATCACGCACCACAAGGCAGCAACAATGTCAACGACTGCACG
AAGAACACTTTCAATCACGCAAACACTGCACCGTACATGCTTGGAGATATCCGTTTGGGAGACGGACTGGCCGGCCTCGTCACTTTCATCCATGGCCGCT
TCCTCATGCTCACTCGGCATTGGCGGCAGAATGGCATGTCGCTGCATCTTTTGCTGGAGGTCATCGCGGAAGATGACGATGTCTTGTGTGTAGTAGCGGA
TTCGACACGGGTTGGTGCTGCACATGACATTTGGCACCTTTCGCACGAGCTCGCGTGTACACAAATCAGGGAGCTGCTCACAACTCCAAAAGTTAGCATT
CGTTAACGATTGATAGAAAAGTTTGCTGTTGCCTACCGGGTGGCGTGGGAAGGCGCGAGACGAGCCCGGGTCGTTAGGCCCCGGCACCAGGACGAAGCGC
GAGTTCTCCGCGATGCCAGGGTACTTCAGGATGAGGTTTCCCAGATCTTCCAAGTATTCCCGCAGGTCTTGCAACGAGTTGGACCCGGCACCTCCGCCGA
TAGATGTGGACATGAAATCACCCATTAGAATGAACAACGTCGGCTGAACGCTATCGAGTCCCTGGAAAAGTTCGTCCAGTTTGCTCATGACCTGTGGGTC
GTCCAGGTGCACATCCGACAACACGATGAATGTAGCATGGTGGTCGCTAGCTTCTAATGTTCGAATCTGTTCCCGCTGTTGAGCCGATACCTCCACACCA
AGAGGGTCGATGCCACCCAGAACCTCCAGAGACGTCTCCTTTGTCTCTGGCGGTGGGAACCCCATTGACTAAAAACAAAAACAGCACCCCACCACCACCA
TTATTCAGCACCATGTCCTTGCAAAACTTTCAGCAGCAAAATTCTTACCTGGACATGAAGCACGTCATCGATCACTTCTCCTTCCACCAACACCACACAG
TTGATTGTGAAGAGGCCGTCAGTGTACACTGCATTCGTAAGATCGATGATAATCCGCGACGTGAAGTCTTCCAGGTACATCCTATTGCGTTCATCCTGAC
CCAGCATGCCAATCACGCGTCGCAAACCCGTCATACCCAGCAGCGACTCAATCCGCGATAACTACACAACACCAACCAACTAAGCTCTCAATCCCCGCCA
CACCGCAACTTGTCCAGCAATGAAATATTCTCTCTACCTCCATGTACTCTGTGGTGTTGGCCAAAGCGGCCGACGGGGGTGCAAAGAGTCGATTTCGCTT
GACACGGAGATCCACCGACATGAATCGATCTCTCAGCAGCTGAATCCGCGACTCAGGACCCGCATGGAGTCGCCGGTGGGCGTCTGCTTTCAGCTCGTAC
GAGTTGTTGTGCGTGTTGAAGTGCAGCCTCGGCGTGTCAAACGCCCCGAACACCTGGATTTGTTCGAAGTCGTTCTCAGCCGAGACGGCCAAGAGCGTGT
CCAAGGCGCTCTCCAGAGCCCCCAGCGTCACCACAGACGTCGTCACTATACATCATCAAATTTAGTCATCTACAGTGCTTTAGAGAACCTTTCAGGCTGA
AAACGCACTCTTGCTACGGTCGATGTTGTTCTTGATCGCGTAAATGACATCCTCCAGCTGTAGGGACGACTCACTGCACACGGAAGGCGAGACATTGAGC
GTTAAATTAAAGAAGGGGTGGACGGCTTCAATGTATTAGTTGGACGCTACTACTGAGCGGTTAGTGGTGAAAATTAGATGAGCAGACGTGCAAGACGAAT
ACGCACTTGGTCAGCTCGTCGGTGAGTCGTCGCAGCGCGTCAGCATGCAGCGACAACCCCTGCAACTTACACGCGCGCAAAACCCGCTTGGATGCCATAA
TTTTGAGTGGAAACGGCGCCAAAAGGCAGTGAGGTGGTACAGTGTGCCATACATGGATACAAACAGTGCGTTGAAGTTGCAGTAGTATTAAGTCTATGCG
GCCAGGACAGAGCTTCTAAGCACAAATCTGTTGACTCTGGCAATCAAAAAGCTGGAGAATTCCTCCAATTTGAACGCGGGTCATCGACTAGTAGGTCTGG
TTGCCGCCTTGGCCCAGGCCCAGCACGTAGCTCATGCCCTGTGCGTCACGCACAGCAGACGAGTCGCCCATGGCTGCAGACACCCGCGAGTAAGTGTTCC
AGCACTGCGCACTCTGCGGTCTCGCGCTCAGCCTACAGTGCAAATGCAACAGAACGGACATATTAGGAGGGCGGGTAGAGGAATAGCATAACATTTTCTT
CGGCCGCATACCTTTCGTTGAGGAGAAGTTTGGCGAGACGCAGATCGTCGCACTTGCTAGCACTGTGTCCCACAAAAGCTCAACATATTAGCTAACAAAG
GCCACGGTTTTTAGGACAGAGATATCCGTACCATTCTATGAGAAGCTGCTCCACAATATCTTGGTCTACGTCAGTTCCGCCAAGGAGGCTAAGCTTTCCA
CGCGCTGGAAGCAATGCTTGGGTAGCATCGTTGAATCGCGCCTAATCATTTTAGAATTCAAGACGAAGTTGGTGAGGCGTGCATTTAGGTAAACAGAACA
GGATGCGAGCAAACACAGTGACTTCACAAACCTCAGCGTACGCTTGGAAACCCTTGCAAACACTGCTGTACACCTCCTCTAACTCGCCTGACAGCACCAT
AGTTTGTAAGCATTTTCACGCATCTGGGTGCTCACCATTCCAACAAGAGCAGATAACAATACCGGGGGAAGACGAAAAGCTAAACTGGAACGGAGTCGTG
CCAAGAGAGGCTTCCAAGCGGCCAGTATCGACGGCGGGATCAGTGACCAAGGGTTCCGGAGAGGGGGTAGCGCCGGACGGCACACACGACAAGATGCTCT
GCGTGAGTATCAAGGAAATCGTTAGATGAGAGCAAGGGGATCGCCGCCACAGCAGGTACTTACGTATCGTAGCACGCTCGCAAGAGGGTGGAGGCGGGAT
GTTGACACCGCATTTGTGTTTGTGCTTGAAGGCGGTTGTACGGCAGACCAGTTTTGGAGGAGGTACTCGCCTAGCTCTGTGTTGTCCTGGCCTGCAAAAC
GCAATCTCCAGTAGAGCTGCGTCGCGTCACACAGCGTTGGCACGGCGTGGGGTGCACCGTCGGGCTGGTAAGGTAGGATATTCACCTCCAGCATCTTGTT
GATGCGGTCATAGTTACCCAAATCCATCATGTACAATGCCCACTGAAAGTAAAGGTGACGCTCCAACGGCCCCCCATTGTCAAAACCTGCCTTGAATTGG
TTCGCATAGCTCGCTCCATGGTTTGCGTTGCCACGCGCTTCTAGGACGTGCAGCATGGTGTGCACTACAGTAGCGTCACAATATTCTGCGTCAGTCTAAA
GCCAATCAAAGACAAATCCGCCTCCACTTACATGCCCAGCGATCGTTTCCATTCATGGATAGCGACTTCTCCGCCATAGCTTCAGCGGCGTCCAGTCGGC
CGGCCGCTTGCATTCCATACGCCTGCATGGCCAGTAAATGGCTGTATGCAGCGTCATTAGGTGACCAAGAAGGCAAACGGCGCGTCACCGTAGCCAACAT
GTTCTTGTAGTCACTGCGACAGCATCCACCCCGTCAATCCCCCCGAATGCAACCTCCGTTCAGCATCAACGTTCCAGCTCACCCCAAGAACTTGTAAATA
TCATAGCAACAGCGCAGCGCCAGTAGGTCCGAGTGATCATGCAGCAAGATGGTCTCGTAGACCGTAGCAGCTTCGTGATGGCGGCCGTGCACCATCGCAT
CCAGCGCCAGCACGTGCATCTTCTCGCTCGTCGTCGTCTCCTCTGCAAGTGCAATTGCAAAACAACCCAGCACTTGAGTCTCTGCACCTCATTTCTAAAT
CTCTCTGTACTCCCCCCACCTCCTTTTGCGATTGTTGCCGCCGTGTCCAATCTGTCGGCAGCATCCAGCGCGTCCTGGTGCATGAGCGGGGCGAGACACT
GGCTGGCGCCCACCAGCACGTGGCCCATTAGAAACGGCGCGTCCTCCTCGACCAGCAGCTGCTGCAGCATGAACTTGGGGTGCGAGTTCATGCTCACGTA
CTGCAGAACTCGGTTAGAAACACGGTTAGAAACGCCAGCAGTGTGCTGCCACGTACGTCCAGCAGCGCCAGGTCGTACGCCTGCTGCTTGCTCGTGCTGC
GACTGAGCGACGTGTTGCGCGCGCCCTCAAACTCGCCGATGCCGAAGATCGAGCCCAGCAGCGACATGGCGCGCGTCGAGCGGCCGCGCAGCAGCGGAAC
TCCTCCGCGCCGCAACATCCTGGGCGAGTCAAAAAAAGTAGTATGGCGCTGTCATTTCGGTACGTGTACCTTGCATCGAAATGATGGCACCCGATGTAAA
AAGGCATGAAAGTTTCCTTTTCACTTTCTGACATCCTACATGTACACGTCTCCAATGCTCTATGCAGAAGGAGGAGGTGCACTCACTTCAAGTCCGATGA
CGAACGGAAGGAGGAGGACGCTTTGTATGACGATATTAGTGGCAAACAGTTTTTTCACCCTTGCATTTTCATTTTATGACTGCATTTCGGTTTTCAGGAC
GCTACGAACCACACTTTCTCACAACTACGGGCGCTTTCTTTCGCGCCGATCACTTTAACATTGAGCACGTCGGATGGACAGACTGGACGGACATCCTCAC
ATCATGTGCATGTTGGACCAGGACTGCATGTCGCCGCCGTGGGGGACGTTGCCTTGGCTGATGGGTGCGGCAGCACCGGTGTTCGTCTCGGAAGCAGACA
TGTTCTCCAGGAGGTCGTCCCAAGGAGCTGCCTGCCCCACGCCACTGCCGGCGTGATATGCTTCACCGGCCCGTGGGTAGCCTGGCGTGGTGATTCCACT
TCTCTCGTGGTCGTGGCTGGCGAGGCCCGGCAGCATTTGCTGCTGCTGCTGCTGCTGTTGATGCTGCATCACGTTGGCAAACCCCATTGCTGGTTTTTCT
GCCTTGACGTCCGAGTACGGCGAGCTGGACGGACGCAAGAATGGCTCGGGCTGATATTGCTGGTGCTGAGATTGGTGCTGGCTGTAATCAAATGGGCCTG
TCGACGATGCTGGAGGGGAGAGGCGTCCGTATTGTGGGTACGCCGCAGATTGGTCCATTGGCAATCCGAAGCGACCGACCTCCACGTTCGCCTCGGGCGT
GCGCATCTTCTTCGTAGGGCGCATTAGCTGCTCTGGCTGCTGCAGCAATGCTGGAATAGACGGTCCAGTTTCCTGCTGCCCCAGCACCGAAGACGAATAC
ACGGCCGCTCCAGTGCTCCACGACGACGACACATTCGTGTCGCTCGCCGTCACCGCAAGCACGGGCGGCATGGGGGTGATGCTGGCGGTGTTGGCCGGCG
ACGGGTGGTGATTCCACGCCAGCAGATCATCGTACTGTCCGTTGCGGAGAAGCTGCATCGCGCGCTTGCGCTTCTTGGCATCGGAGACGTCGAGCCCCAT
CACGGGCTGCCCGATTAGCACCGAGAACTTCAGAAAATTGTTGACCCAGAACTGCTGGACGGCCAATCGAAGGTGCTGAGTCTCCACGAGCGCGCCTTCG
TCCGTGTTGTTTTCGCGGCGGAACTGGTCCACCAGCTCCTGTCTGAAAATCTGCTCCAATCGAGACAACTCGCGCTGTCTCCGCGCGTGGTCCATTGGGT
CGAATTGCATGGCCTTCTCGCCCTTGCCAGGCTTGGTCACTCGAAACGTCCTCTTGCCCAGAGCATTCTTCTGGAACTTTTTGGACAACCTCATGGTTGA
ACAATTGAGCATCTTAGCGAGCACCAGCCGAATGGGCGTGCCGTGCGCTAGAGGCAACGCTTGTCGGTCGAACTCGCACAGAATGCCGTCGATGAATTTC
TCCTCAGGTCGAGTCCACTTCCCGCTGCGTGGCTCGGGCTGTACCATCATGTTGATGCTCGGGGAGATGGCTACCTGGTCGAGCGGCACCGCGCAGGCCG
GGCATGCGTCCAGCGGCCACACGTGAACGCAGCGCGAGTGAAAGGTGTGATTACAGTTAGGAGATACGAGAACAGGGTCGGGGTATTGACAGACATCACA
CATGCGCTCCATGGGCATCGGAGGCTCTGCGTGGGTCTCCGGCGCGGCCTGGAGGCGGTAATCTGACTGCTGCTGATAGGCCGCGATGGGCTTGTGCTCC
ATTGGGGACTCGGCGTACGGGAACTGGGAGATGGCGACGGGCGTGCGGCTCGGCTGGTAGTACGTCTGCTGCGGTGTGTACTGCTGCGGCAGCGGCGACG
GCTGGTAGTACGTCGGGGCCTCGAGCGTCGGCCGCATGCTCGGGACCACCGGGCGGTCTCCGGTGATGCCGGCGCCGTGCTGATGACTGTACTGCTGGCT
GTACTCGTAGTCGTATTCGGGCTGGTGGTGGCCCCCTCCACTTGGCTGCATTCTTGAATTCTTGAAGACTGGCTCAAAGACTGGTGCTCGGGCCTCACAA
ATCATGAAGCGAGGGGGATCAAGCACTTTACTGGTCACTCACTCACTAGACTGAGTCCGCCGAGGTGAGCGGAGCTTTCGAGTAGTAATGGATGAATTCG
CAAGTGAGACTCAAGTCCTTGGCGAGAGGAGGGGGAGGAGCGCGGTTGGCTGGCTCAATTCGGCAGTGGCAGTATCAGGCGATACAGTACAGTAGACACC
ACACACAGAACGAGAAGGTCCAGGACCAACTCCGTTTCTGTCTTGCCTTGCGCTTCCTTTCCCCTTCTGGCGTTGGCTCTCGGCAGTGGAGTTTCCTGGG
CTGGCGGGGTTAAGGAGAAGCCGCACAATCGCGACCGAAGGCGAGGGCGATTTGCTGATGCCGCCGATTGTTGTGACGACGGCGCTCGGCGAAAGTGCGC
CTTGTTGCTGTTTCCTCGAGACCCGGTGCTGCCACGTCCCACTCGGCAGCGGCTGTTGCAAAGTGGCTGTCCTCGCGGAAGCGCCCGTGTATGGGTCACG
TGCGTTGACTAAAGCGCAGGGCTCCCTTGCCAAAGGCCTTGGGCCTTGTTCGAAGACGGTGAGATGCCACGTTGGACGAGCCGGAGCCGGGCGACTCCCC
GGGTCGGTGCAGCGCGCGTATTGAAGCGATGGGTAGCACCCGGTCGGACTCAATCAAGCGGGACGAAAAGGACTGGCA