Description :
From Genome Similarity Track
Location :
Scaffold_1124:9014- 10677
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1124-fgenesh-gene-0.1Integral membrane protein

Sequence
1663 bases(100 bases per row)
AACGAATATGAGCAGCGCATGGGAGCAGTGGGGCAACAAGCGCCCGGCGGCGACGGCCGGCGCGGCCTTCCAGAGTCTGCTGCGCAGCTCTCCGCTTGCA
GCTGCCACGTCAGCAGGCGTCTCTGGGGGCAATGCAGAGACCTCGGCCGCCAGCGCTTCGCTCAGCGCCGCGCAGCTCTCACTGAAAAAAATGTGGGTCT
CGGCGCGCGACGTGACCATGAACGCCGTACAGGCGGCGTCGCCAGCGTCCTCGACCGCGTCCACAAGCGCGTCGTCCGTGGACCTGGAGGCCATGGAGAG
CGGAGAGCGCAGCGAGGCAGAGGACCAGGAGAGCGCGACGGCGACGTGGCCGCTCTTCCGCCGCAAGTCCAGCGCGGGGAGCTCGCTTTTGCCCGCCATG
AGTTGGTAGGAATTGCTGCGTTTACACGTGCGTCTTTGTGGCTTTAATGTGACTAACCATACGCATGTTTGCTGTGTTGTTTTAATTAGGAATACGCGGT
TCAAGTACTTTGTGGGGATGACGCTCATGGGACTCATGTTCTTTGGAATGGCGTCCATTTTCCTCCCACTGGTGCGTTTGGCTCTATGTGTGTGTGTGAA
TGCGTGTATTCTCGTATGTAACTCTGTGATTCTATCGCTTGCTGCAGATCATGATCCGGCCGTCAAAGTTCGCATTGAGCTTCACATTCGGGAGCATGTG
CCTCATGACGGCGTTCGCGATGCTCAAGGGGCCGGCCACGTTCGTCGCGGGGCTGCTGGAGCCCAAGCGGCTCGCACTCACAGCCGCCTATTTCTTCTCC
CTGGGTACGTTTTCTCATCGCGACACACATACACTATGTATTACTAGAGGACAGATCTGATGACAACTATGCTCATGTATGTGTCATGCAGGCGCGACGC
TGTACAGCTGCCTGGTGCTGGGCAACTACGTGCTCGTCGTCTGCAGTTCTGTGATGCAGGTACGAAATGGTCAATTCGAAATGGTGCCTTGCGCGTGGCT
GTATAGATTGTGTACTGACGTTCGCTGCTATTGTTTTCTTTGAAGCTCATGACGCTCGGCGTCTTCGCCATGGCGGCGCTCCCTGGCGGCAACGCAAGTC
TCAAAAGTACGTACAGTGCGTGGAATTTATATTGATAACGCGAGACTCAACGCTAAACGAACTGCTGCATGTGTCTTGTCCTCGTAGCGTTCGGGATGCT
GTTCGCGAAGGCCGCGCGGCAAATGGTTCAGACCTTCGCGCGCCTGTTCCGGTAGTTTATGACGCTTTGCGCGGTCGCGTCTGGCTGGCTGGCGATCTAC
TTGTCGCTCCGGTCGCAGCGCTTGCGAGTGGCGTGGTCGTCCATGTCGCTCCACGCCTGTTATAACAGCACAGGCTATATTAATTAATGCACAGAGCTAT
ACACCCTTTCATTCTATTCAATCGTACCAGTCGGTCGTCGGTGACCTTGAGCGGGTCGTACGCCGGCGTGCGCTCGTCCAAGTACTTGATGCCCGCCATG
AGCGCCACGCAGAGCACGGCGTAGCCCGCGCTGTCAAACATTAGCAGATGTATGTGAGCATTTGCAGCTAGTGGGGATGGATCCACATGCGCAGAATCGT
GAGAGTGAGCACGCACCTCTGCCTCGTCGAGAGATTCCGGAACGGCAGGAACATGGGCTTTGG