Description :
From Genome Similarity Track
Location :
Scaffold_62:90110- 94777
Sequence
4667 bases(100 bases per row)
AAATACCTCACGCGATATGGTATCGAGAGGAAGCACAATATTTGCGAATGCGTACATTTGGATGTGCCGTGTTGGCGTATGTAGATAAAGTTGAGCGGCG
CAAGATGGACCCCAAAGCGCGTGAAGCCATTTTTGTTGGATACAGTCGTGAAAAGCGAGGGTATCGTCTGCTGGACAGCAAGACCCGAAAAGCTTTCTAC
AGTCAAACGGTTGTGTTCTTTGAGAATAAGGCAGGCAGAATCCTATCGGAATCGTCTACCCCAATGTCCAGTAGTGTGTCCACTCGACAATACCTCGAGG
TTGAAAATACTACAATGGAGAGCATACCAGCGATGCTGGATGAGATGTATGAGAAGATGCATGATGATGCTCCTACAACCAACAACTCCAACCAGAATCT
GGCAGGTGGGGCAATTGAAGGAAGTACCAGGACTGGTGGGGCTGTTGGAGGACACACAGGAAAGAGAAAACGAAGCACTGTGCGTGCAGGGGGCAATGAA
GCTCGAACGAAGCGAGTATGGTTCAACGATGAGCCTTCAATGCGAGGCACTGAGCATGTTGCAGTGCGCGGCACTGAGCAACAGCCTGCACACGTCCGAA
GTGACGGTGCTATTGACTCAACTTGCCGAGGCAAGCACAAAAGCAAGCGAAAACGCCAGCGTGGCCGACGCAAGGCTGTTACTGAGTCTCAAACTGCCGA
GTCAGGGCAAGAAACGGCACGTAGTGGCTTGCCGACCATGGAGAGGCCTTCTTCTCTGGAGAATCGTGCAATCGAGACCGCGAACTCGGAGATGCTGCGA
CCAAGTGACGACTCTAGCACAGAGAGTATAACAACCTCTAGATGCAGAGCGTTGCGAGAGTATGTGGCTCCAGAAGGTGTTCACACAAAGGACTACCCAG
TAACACGGAGTGGTCGTGTGAGCAAGCCGCCCTCCATGGTATGGTGATTCCATCTGTGTGGCATATCTGCATACCAATGAAGACTGTGAAAATGAGTCTC
CAACATGGAAAAGAGCTCGAGAAGAAATGCAGAGAGAGATGGCAAAGGAACAAGTTTGTGCATGGTGGCAAGACTATTGTTGTCTCACCATGAGTGCCAT
ACAAGAGCCTGAAACGTTTGAAGAGGCAATGCAGGGTGAGTTTTCCATGCAGTGGAAAAGTGCGGCTCAGAAAGAGTATGATGCTATAATGAAAAACTGT
ACGTGGGAGTTGGTTCCACGAGGCAGCAACATGAAGGTGTTGCGAAATCGGTGGGTGTTCCGCGTAAAATACCTTGCAAACGGCGAGATTGATAGATTCA
AGGCGAGATTAGTGATCAAAGGCTTCATGCAAGTCTATGGAGTCGACTATCTTGAAGTGTACTCACCGGTGGTGCGATTGGAGACACTGCGGGTTCTGTT
AACCCTTGCAGCTGTGTGGGACTATGAGGTTCATCAAATGGACGTTACAACTGCCTTTCTGAATGGCAAGATCGATATGAAGGTATTTATGGAGCAACCA
GAGGGATTTAAGGTGCCTGGTAAAGAGAACTGGGTGTGTTGCTTGCTAAAAAGCTTGTATGGCTTGAAGCAAGCACCACGTGTGTGGTTTCAATTACTGA
AATCCGTTCTGGAGGAGCAAGGCTTTACGTTGCTGAAGTCGGAGACATGTGTTGCTGTCAAGGTCATTGATGGGCAACTAGTATTCATTCCGTTGTACGT
GGATGATCTGATCCTATTGGCTCCTAACATAAAACTTATCAACGAGATGAAAGAAATGTTTCGTAAGCGATTTGAGATGAAGGACCTGGGAGAATTGCAC
TATATCCTGGGCTGGGAAGTTACACGCAATCGCAGTGAACGAAAGATTTTAATTAATCAGCACAAGTACGCTATGACAGTGTTGGAGAGATTTGGAATGG
AACACTGCAATGGGTGTAAGATGCCATGTACCCCAGACTTGAAGTTGACAAAGAGCATGTGTGCTGCAGATGCAGATGAAAGAACTCTGATGAAATCTAA
GCCGTATCGATCAGTAGTAGGAAGTCTGATGTACCTAATGATGGGCTCACGTCCTGACTTAGCGTATTTGGTCAGAGAATGCAGTCAATTTCTCGAGAAC
CCAGGAATACTTCATTGGCGAGCAGCTAAGCGAGGACTACGGTATCTTCGAGAGACTGCTGAATGGGGTATTTGTCTCGGTGGAAAAGAATGGATTGACC
AGGAACTGGATCAACATCTACAAGCATTTGTTGATGCTGATTTTGCTAATCGAGTTGATGACAGGAAATCTATTGCAGGATACTTAACGAAATTCTGTGG
AAGTGTGATCTCATGGAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCGCAAGATGGACC