Description :
From Genome Similarity Track
Location :
Scaffold_422:9010- 10415
Transcript NameFunction/comments
Hyaar_Emoy2814107hypothetical protein

Sequence
1405 bases(100 bases per row)
GAGAAGACGTCAGGATTGGAATCTCTTGTAGACGTTCCTCTTGATCAGCCAATTCCTCTTGGAATTCAGCGATTTTCTGTTCGGCACCAGCCAACGAGTC
ACGCAGATTGTTGTACTGCTTGTTCACAAATTGCCGGATCGGTCCTGCGAATTCTTGAACGTCGCGCAGTTGGCGTTCCAAGCGATCAACGCGAATTTCT
TGAGCTCTCAACTGATCGTGGATCGCACTGGAATCGGTTAGCTGATCTTGACGGGCCTCAGCACAGTCGTAGAGATCATCGATATACGATCGTAAGGTAC
GCCGATCGATCGCAGGGAAAAAGCTCACGCGGCCGCTCGGAAACGAAGACGGAGAAGGTAAAGGGACTGCGGCTGATGGCGGGGAGATTGAAGCTTTAGA
CAGGCCCGGGCAGGTGATCGACTCATCAACAGAGTCTTCCATGAACAACAACGCGTACAAGCAGATCTACGGAGATAGAGATTACCGCTGACGAAGTGCA
CAGATACATCAACACTGTATGTCGGTTACTAGTGCAGAGGACGGCTGTGGTAAAGCGGACCGAAGCAATCGGGGGCGATCGTTGGGTGGAGTGATCTCAA
ACCGCGACAGTTCAGTGAGAAGGATCGATTGGCTGTTAAGCTGCGCAATTCCAAGATTAAATATCGCAATATCAAGATCGAATACCACGATACCGAGAGT
AAATATCGCAATACCGCGATCAAATATCACAACAACGGGATCGAATATCAAGTTATCAAGATCGAGGCAAGATACCAAGATCGGGAACACATAAGGTGTT
CAAAGTCGGGAAGATGACCGACAAATCGGCAGGGATCACGGTCCTAGAGAGTGATCGACGATCAGGAGATTGACGATTGATCAGAAGATGATCGAACAAG
GAGATAGATGATCAAGGAGATCGTCGGTCGGTCAAGGAGATCGATGATCTATCATCGGAAGTGGACCACATATGCGAAGGAACGATCAACGGAATGTAGA
GGACACGTGGCAGCATATCCTGGCACATAGACAGTCATATTCGTAGTTTTAGCTTTTGGTTGGTTGACATTAAACAGAATTCGATTTGCTTCCAAGTATA
CGTGTCGACTTCTCTTCCGGGCTGGAATATTGGCCTCCCGACGTCAAGAAAGCCGCGCATACTGAAACCAAGTGATATGTCCAGATAATTGGCTGGGGAT
CAAGAATTCTCAAGACAAACCCAACTGCTATTGGACGCAGAAAGAACGTAAAGGACAAGGCGCAAGATCGTGAGACGGCTCAAGTTGTCAGAAGGCTCGC
GTATCAAGCATCCACATAGTGGACAAGGCGATCTCGTTGAGATCTAGGTGGCTTACATCAAGTAACCTACAAGTATACCCGTGATCGTGTGAAGGTTTCC
GCGCG