Description :
From Genome Similarity Track
Location :
scaffold_1253:901- 5415
Transcript NameFunction/comments
g11219.t1 reverse transcriptase

Sequence
4514 bases(100 bases per row)
ATCGCAGTCGTAGTCGCAGTCGCGGACGTGGGCTCCGCGACCTCTCGGAAGGCTTGCAACATTATCGTGGGCGCCCGCGTTCACGTAGTCGGGGACGTTC
TCGAAGTCCGCGCCGCGCTCCCGTAGTCGCGATCGGCGTGAATATCAAAACCGTGAGGCGGAACGCCCTCTCACGTTGTCGCCAGTACGAGCGAGGCTTC
GTAGTCCCTCATCACGTCGGGAATATCCTCCATCAGGGCGCTTCGGGGCTCCCATGTGTCCTCCGCTGGCGAATATCCCAGCCAGCGGACCCGATAATGC
TTCTCAGTGGCGGACGCCCGCGCATTCTTGGACCGGCGACCGGGGGCACGGCGAGCACGCGTATCATGGTCAACGATACGCTCGGCAACCCAGCGCCGAG
CGCCCGACGCGTCTACAAGTGCGGGCGGACCGTCTCGACGAAAGAGCGGACCATGAGCGTGGCGCGACGCTTCAGAGCCATCACTCTGGAGGGGCGTCGG
TTTCGTCGGTTTCGCATGTTGACGAGACGCGCTCCGGGTGGATCAGCCGGAGCGAGTGTCGATTGCACAGTATCGCTTGATGATGGCGGAGGTGCAGCAG
GCGAGGGACAACGCGTTGGATGCGCTTCAGGCGCATCGCCGTTGGTTTGTCTAGCGTGTAGGCGTCTCCATGAGCTCGCATAACCATGAATGGACCAATA
AATCTTGGTGCTAATTTGTTTGCGCCCAAGTTCGTCGCTGCCGATGATTGAATTTCGGTGGTCGATAATAATACGCGGTCGCCACGTCGGAAGACAGCCG
TGTTCTTTCGACCTCTTTTATCGGTATTCTCTTTCTGCTTGTCCACGGCTGCTTGCAGCGCGTTACGCACGAATCGCGTGACGGCTTGGCGCTGAAGCAT
GACCTCCGATACAGCTGCGGACCTGATCGGGGTAGCACCTTCCTTTGGGGCGAAGTTTGCCACGGATGACGTGACGCCACCCGTCACGTCCGCCGTGTCC
GTAGCCAATGGAGTAGCAGCCTTCGATCGAGTTCTCGACGCGATACTGTTCACCGCTTCGGCACTGGTACCAGGTACCAGCGCCAACCCGTTATCGTCTT
CACTCGGCAATAGCGCCGACAGCGTCGGCGTAGCCTTATCTTCTCCCCCACCAGGAGTGGAGCCAATATCGTCCGAAGGCGTTGTCAAGCCGAGCATCGC
GGGAACGCGCGGGTGACGCGCGCTGTTGACGAAGAACGGGGTCAAGCCCGCGGACGCGTGACTCGCATTGTTGATGGCGAACTCCGCCAGCGTGTTGACG
GCGAACTCCGCCAGCGACAGGAAAGAGCTCTATGACTCGAACGCTGTCGCGTAGCTGCGCAGCACGTCTTCGAGGACTCGGTTCACACGCTCCGTTTGCC
CATCCGTCTCTGGATGGACCGCCGTTGACATGAGGAGGCGCGTACCAAGCAGCTCGAAGAGGCGGTCCCAGAACGCGGAAGTAAAGCGGGGATCACGGTC
GGACACGATAGATTCCGGCAGGCCATGGTGCCGGAATACAAGTTCGAGGAACAGACTGGCCGTCTCCTCAGCGGTAATTTGGGCGGCGACAGCAGCGAAG
TGGACCATTTTGCTGAAGCGATCGACGAGCACCAGGGCACCAGTGCAGCCCTGGCTGTCTGGCGGTAGACCGAGGACGAAGTCCATGCTGACAGATCGCC
ACACTTCTGCAGGAATGGGAAGCGGCCGCAAAGGAGCTTGCGACGATGGAGAGGGCTTCACGCGCTGACAGGTCTCGCAAGAACGGATCCACTTCCGTAT
CCACTTGTACATCCGAGGCCAGTAAAAATCTCGGGAGAGCGCGGCGAATGTCTTCTCGCGACCGAGATGTCCGCCAACAGGAGAGTCATGGTATTCATGA
ACCAGGCGCGCTCGAAGGTCGTCATCGGCAGGAATGACGACTCGCGGAGCGTCGAAAGTGTCCATCGTATACGTCAGCAGAGATCCATCAAGCTGGTAGC
GCGCGATGTGGTCGCGTGTTGGACGCGTCAACTTCTTCAACGAATCGGCGCAGGGTTTCCGGAGGTGCGCAATGATGTCGGCGTAGAAGGAGTCAGCGTC
GTATGCTTCAGCAATCTGTGGTGAAACTGGAGTCGATACCGTCGCATTCAAACCCAACGCGACGCAGCAAGCACATTCATCTTCGTCTTCGTCATCAGGT
ACCTGAGGACCAATGTCGCGGCGTGGGTCGTAGTCCGGACGGCGTGATAGCGCGTCGGCAAGAATGTTATTCTTGCCGGGTTTGTAATGGACTACGAAGT
TATACTCGGCAAAGAAGGACAACCACCGCGCCATCCGCTGGGACAGATGTGGGCTCTTCATCGCGGTTCGCAGGGAGGCGTGGTCCATATAGGCCGCGAA
CGTCTGCTCTCCGAGGAGGTACACTCTGAATTTAATCAGAGCGTAGCGCATCGCGAGGAGCTCCTTGTCGTGGACGGGATAATTCTTCTCAGCGGGCTTC
ATTTGTCGTGACTGGTAGCTCACGACACGCTCGCAGCCCTCATCATTGAACTGCATGAGGGCGCAGCCGATGGCGAAGTCGCTCGCGTCGCACACGACAT
GAAACGGTTTCGTGTCATCCGGCAACATCAAGACAGGAGCCTCAGCCAAGCTCTTCTTCACAGCGTTGAACGCGGCTTGATGTTCGGGGCGCCACGACCA
CGTAATATCCTTCTTGAGCAGCGACGACAGCGGGTGGATCAAGCCTGCGTAATCCTTCGTATACTTATGGAGGTAGTTCGCAAGGCCCAACCATTGCCGC
AGCTCCGTCGGGTTCTTGGGTGTTGGCCAAGAACAGATCGAGGAGATCTTTTCAGGGTCCGCCCGGACACCGTCCTTGCTCACGTAACAACCAAGAACCG
GAATTTCGGGGGCACAGAAAACGAACTTCTTCAGATTCGCGTACAGCTTGTTCTCGTGCATCACTTGGAAGACCTGCCTCAAGTGCCGCAGATGTACGTC
GACAGCGCTGAGACCCTCCTCAGCGCGGCTGTGGACGAAGATGTCGTCGAAGTAGCTCGGCGCGAAGTCGCGGAGTGGACGCAGTACGTGAGACACCATT
CGATTGAAAATGGCGGGAGCGTTCTTTAGACCCTGTGGCATAACGATCCACTCCCAAAGCATGCCGCTTGGGGTGCTGACGCCCGTGAGAGGTATATCGC
CCTCTCGCATGAGGATCTGATAGAAGCCATCCGTCAGGTCGATCGCGCTGTAGATCACGCTGCCCGACATGGAGTCCAGTACCATGTCCTTCCGAGGGAT
CGGCGTCTGTGCTGGGATGGTCGCGTCGTTCAGCTTGGTGAAAGCGTGGACAATGCGCCAGCCACCCGTGGCTTTCTTCACGCAGAAAGTTGGACTCGAA
TGTGGCGAAATACTCTCGCGCACATGACCCGCTTTGCGCCAACTTTCGAAGAACTGATCGATAGCCTTGACTTGGTCCCGCGGCAGTGGCCACTGACGTG
TCACGCAGTACTTCGTACCAGGCGTGAAATCGATCTCATGTCGTACGCCGCGACTGGCTGGCAGTTCAGCGGGAATCTTCTCCGGGAGGACGTCTGCGTA
CTCGCGGACGGTGTCGTAGGCTGGGTTCCCCGAGTTGCGAAGAGCTTCCCACGACTGGGCGGCGAAGCGTTCTTCGCGGGCTGTCTTCGGCTCGGCCCCC
ACAGGTCGAGTCGGCACGTCTTCCTTGCTGACTGCGTTGAGGTCGTGCGTCGAGTTGGCCTCAGTGATCAAGCACACTTGCTCGATGTCGCCGGCCTTCA
AGTCGCGCAGGCAATTCTTCCAAGACAAGCCTGGGAGTCTCGTTATCGTAGCTGCGTCGCGAGGGGGACTTGCGACTTCGGTGGTCCTACGACGCTGTGG
CGAGCCTTCGATGTATTCCAGCGCACAGATGGATTCCATCGCAGGGGCTGAGTCTTCCCTTGGGCGTCGCGACTTAAGGCGACGGCGCTTCGACTTCTTC
TTTCGCCTCGAGCCTCTGCTCGAAGCCGAAGAGGCGCTGACGGTGGAGAGCGTGTCACCCTCCTCTAGGCGCGGGATCTCGTTCTCAACCGCGCCGGTCT
CATGCGGGAGTCGCCTTCGCTCGACCGCCTCGTTGTGCTCACGACGACGTGAGTATTCCCCGCCGCCGAATTCCTCCACTTCCAGGGAGACCGCACAGGC
TGAACATAGAGGACCATCGCTCTCTCTACATAAGGCGTGTGTCGTGGTGGCACCGTCCACGACCCGGACGTGCGGCCAGTCGGACGGCGCGACCAGGAGG
TGAGTGAAAACCTCGCTCACGTCAAACCCACTCCGGCGTTTGACAGATCGAGCGAGCCAGTCGATCTCCGGCTGGTACCGTGAGAGCCACGGGATCCCAA
GGATACAGTCGAAGGCGTAGTTCATCTCAAGCACGAGGAAGTCGTCATTACTCTTGAAGCCATCAAACGTATACGGCAGCGTGATATCGCGCCGCGAGAC
GCGGTGTGGCTTAC