Description :
From Genome Similarity Track
Location :
Scaffold_218:901- 2472
Transcript NameFunction/comments
Albla_Nc14101590

Sequence
1571 bases(100 bases per row)
ACTTCCACACCTTTTATTAAACGCAAGAAAATGTTGAGTTCTGGTTCTTTCTCGGCCTTCACAAAGGCATTCGGGATATCCCAATATTTAGCTGCTACAT
GCCAATTTCTAGCTAGCGCTAGAATTAGATTGAAGCTGGTCATATCCATGACTGCCGCGAACGTTACCTTATGATCTCGGCCGAAAACTTCTTCGTTCCC
GCAGGCAACTAGTCTAGCTTTGAGTCAGTCAATATTTACCGTTCGCGTCTCTTTTAGTATTGTAAACCTATTTTGCGAGCAGAATATTAGCACTCGTGGG
TAGGGCATTCTATTCCAGACACCATTCTCTTCAAGTGCATCCAATTCTTCTCGCATTGCCTGCCCAGCGTTTTATGGATCCACATCCCGCAATAAATTTA
CTAGACCTGTTCCACGTTCACCACTTGATATTTGACTATTTTTTTCTGTTTCTTCTGCTTGATGAGAGCCCGTTACCGGTCTTTCTCCGGTCCAACCAGG
TTTCTTTTTCTTGGATATAGTAGTCCCACCTTCCACAATGGTATCTCCAGTCATGCTGGGCAACTTAGAAACACGTTTTGTTTCCCCTCCTCATTTAACA
TTTTGCTGAGTTTGCTTTTCCTTTCTTCTCTGAGAGTCTCACTGTTCTTCACATGCTGTGTGGTGATCACGACGCGATCTTTTGGCAAGTAGACGCAATA
TCCTTCGGTGGCATCTCCAATGCCAACAATGAAACCACGCTGACCCCGATGCGCAAAATTTTGTTTTCTCGGGTCACGATAATCAGTACATGGAACTCCA
AAAATTACAACTTAACCGAGTGAAGGTGTGATTTCCGTCAGGAATTGTATTGGGGACTCTCTGCCAGGGTTCACACTGGTAGGTGAGTGATAAATAACGT
ATGCTTCGTATTGAACTGCGTCCCACCAAAAATGCAATTGCAAACGCATTCCAGAACCATGCATCTAGCCATTTTCATAATCGTTAGATGCATTCGTTCG
GTCTTGCCGTTGCTTGCTTGATTTCTCGCTTCACTGCGCTGTCTAGCTACACCGGTTTTCTTATAAAACAAATCGATGTTCTAATATTCCCCACCCAAAT
CAGTTTGTAAAACATGGATCCTACATTTCAATCGATTTAAACTACAGCAAGAAATTATCGAATTGTGCGTACCAGCATCTTTGGTTTTGGCTAGAAAAAG
CTTCATGTAGTTGCTTTTGTGATCCACAAAGTTGACCATGTACCTAATTCCAAGTCGATCTCGTGGAGTCATTGGGCCCTTTGAATCAGAGTATACGACT
CCACCCACGCGGTCAATAAGCAAGTGATCACCTGAGTCGTTTTGGCTTGTCCATTTATGCTCCATTTGCCCTAGGCACAGGTCAAACAATTCTCGCGTCT
AGGATCCGTAATCTCTATTCCAGATGCAGGATCCTTAGCTAGTCTTTCGATAGAATCGTAGTGCAGGTGTCCAAATCTTCGATAAAACTCTATCAACGAT
CCGTTTTGCATCGCGCTTAGCGATTCCTCTGGATCTTCACAAGCCTTACCGACAGCCGACATAATGACTCC