Description :
From Genome Similarity Track
Location :
scaffold_16:90095- 105005
Transcript NameFunction/comments
g957.t1 conserved hypothetical protein
g958.t1 hypothetical protein PHYSODRAFT_466632
g959.t1 conserved hypothetical protein
g960.t1 hypothetical protein PHYSODRAFT_248463
g961.t1 hypothetical protein PHYSODRAFT_470700
g962.t1 hypothetical protein PHYSODRAFT_477864
g963.t1 hypothetical protein PHYSODRAFT_551952

Sequence
14910 bases(100 bases per row)
AAGACATGGCATATCGTGAAATTGTTGAGTTGATTTGGCACTGCCGACGAAGCAGCGCCCTCATGAGCCCGTTGCGTTGTGCAGCATTCAACATTTCGAG
CAATTTACTGTGTACGATGGCGACTTCGTTGACAGCAGGTTGCAAGCTCGTTGAGCTCGTCATTTCAATAGGATGCCGCACGCAGTGGATCTTTTGCAAC
AGCCACGACGCGCGCTGCCGAAGAGGAGTGGCGATCCTGTAAGGTTGTTACAGCGGTGCAACCTTCATTACTGTGAGCTAGACGTCGCACAGTAAAAACC
ACAAGCTGCCAACATGTTTTCGCGGAACTCAACTTGTTGAGACCAGCCAAATCGCAGCACATTCGTTATCTACAGGTGACCAAACACTCACCCACTATTT
GATTTTACATTTAATACACATCACAGGTAACAATATTATAATATTTTACAGGTTACGTTTTGGCTATTTCTTCCCACCTTTTAGTGCACCTCTTCGCCAT
ACGCTATGCCCCCATTTCGATGATCCACTGGCGCTCCCCATGCGCTGCCGACTGCTTCACCTGGCGGCGCTGCTGACCTGCCTCAGCCGCGGCGCGACTG
GCGATGCCTTGCAGCCCACAGCTGTGCGTCTGGTGACCATCCACCCGCACAACGCCAGCGCCTTCACGGAGGGGCTCGTGTTCGATGACGGCGCCCTTAT
CGAGTCCACAGGCCTCCATGGGGAGTCCTTCATTCGCAAGTACAAACTGGCGGACCTCAAGCCTGATTTATTCAAGGCGGACGCTGTACAGTCGGTGCCT
TTCCTGCAGGAGTTCCGCTTCGACTCCGCCATCTTCGGCGAGGGCGTGACCGTATTGGGCGACAAGCTGTTCGCGCTGACGTACAAGGCGGAGCAGGTGC
TGGTGCTGTCACGCCATGACTTCCAACTGGTCGGTCAGTTCCCCCTCACGACATCCACCAAGGAGGGCTGGGGACTCACGACAGACGGAGAGTTCCTCAT
TGCCAGCGACGGATCCGCCAACGTGCAGTTCTTCGATCCGCACGACGACTTCAAGCTGCAGCACAGTATCACCGTACGGAAAGATGGCAAGGCCGTGACC
AACGTGAACGAACTAGAGTACGTGGAGGGAGAGCTGTTGGCCAACGTGTGGTTCGAGGACCATATCTTGCGGATTGATATCGAGACGGGGGACGTGCTGG
AACAGATCGACCTGGACTGGATACCTAACATGGTACCCAACCTCCACACTGAGGCCATGAAGATGTCGGCCTATCAGCAGGACGCCGTGATGAATGGCAT
TGCTTACGATCCAGTGACACGTCACATATTTGTGACCGGCAAGCTCTGGGACTCCATGTTTGAGCTTGAGCTGTCGTATCTGAACTCGCATAACCGTCAT
ATTGTCCCTTAGATTGTGGATCTTGTTGCTGGCTCAAGAAGAAGGCAAAGCAAACCGTGTATAAACACCACTTATATAAAAGGATACTGCGACTACGATC
AAAGACAGAGAGATACGTACGCCCGCTTTCGTTCAGCAGGGAAATCGGCGTGGGGGAAACAAACGTGGAGCAAGTTGCTTAGGCGAACTTCTCCGAGTGG
AAGTCGAAGATGGTGCCTTCAGCCTTCGAAGACGAGTATTTCTTGCACACGTTGCTAAGCACTTCTTCCAGTTCGTGAGGTCCGCAGCAGAAGACGCCGA
TCTCCTCGCCGGGGTGCTTAGCTCTGGCCTCCGAGAAGACCTTTTCCCAATCGGGGCGGCCAAAGTGCGTGAGCTGCTTCGTGTCCATTCCAGATACGAA
ATCCTTGCCCGTTTGCTCGTGTACAAACTCCTGGAACATCTTGAGCTGCGACGTGTTCTCCTCGCCACCAAGCACCACTGTACTCAAGTATTGGTGGGTC
TCGATCACGTTGTCACGGTCCATTTCAGCGATCTGCTTCATGGTGCCCTCGAACCAGCTTAGCGATTCCTGTCCACGGGTCACCCAGTGGAAGTAGAGCT
TCTGAATCTGGAAAGAGCTCGGGTGACGGACGTGGTTGCAGTTCAAGCAACGGTTGTCCTCCCAAAGATGAACAACATCCTTCAAAATCGACGCAAACGG
GGTGACACCAATGCCACCGCCAATGCAAATCACAGTCTTGTAGCGATGGTAATCCTGAGTCGGAGCGCCAACCGGGCCGTCCAAGTACACATCGGGGTAC
TGCAAATTGCAAGCGTGACAGTCCGCAATGACTCGGGCAATGGCATCCGTCCAGTCGCCACATACACGAATGTGAATGCTGATGTAATTGTCTCCAGGAG
CTGAGGAAATCGTGAACGGGTGCCACTCGTGGGAAGAAATCTGCGGGCAGTTGAGGTACAGGTACATTCCGGGTCTGTAGACGAATCGACGGGGTTTCTC
AATGAACAAGGCTACGGTGCCGTCCAGCTCCATAGCTTCCATGATGCGAACGGGAGCAGCAAACATCTTGGCATAGCGGAAACGACGCTCGATCAGATAG
AGGAGGAACGGAGGCGTGATCCAAATGTAAGCGGAGCAACGAGCTAGCCATGACGTAGCTCCGTGGAACGCAAGCACGATCAGGAAGGGTCCGAAGAGCA
TGTGCGAGTACCAGAAGAGGTTGAACTTGCCCTGGCGGAACTTGGGGATTGCAGCGAGAGGGAACGAAATGCAAGTGATAACCAGAAGGATCACACCCGT
CCAGACCGGGAGAGCCTGTAACATCGTCGTGAATGGAGGACGTTCACCGTTCACGAAGGTCGAAACGTGGCGAGTCACAAAGATGGAGCGCTTAACCTCG
TCCGGGGTGGCGATCAGGTACAGGTAGATCTCGTTGAAGACGTGGGCGATGGTGTGGATGAGACCAGCGATCAACAGGACGCTGCCCGAGATCTTGTGGA
AAGCGATGTGGTCATCGAAAGGGATGATACGCCACAAAAACTTGCTGCGCTTCATCATCTGAGTGATTGAGCGGCACATCGGCAGTAGAACGAACACGCA
GTTCAACATGGCAACCTGCGCGTTGGCACGAGCAATACGGAGACCCCAACCGATCGCTGGGTCCACCTCGTACATGAACCACTTGACCCAGAAGGCGATG
TTGTTGACGATGAAGTAGAAGAAGAGCCACCAAATACGGAGCTTGTTGTCACTGTACCATTGACCAAACTTGCTCTTGGGGCGAATGGGGGCGGAGTACA
CGGGTTTCGCCTCCTCGAGATGGTACGAATCCGTTACGTACGGCTCGAATACCCCGCAGAACTGTTCGAACGTCATGGCGTCATTCTGAACACGAGCTTT
TCGGAACATGAGCTTTGCCACCGTCCGGAATTCCATGCCCACCACATCGATCTTCGCACTGGAGAAGTTGGACTCCAGCAACTGGACAATCTGCTCCTCA
ACCACATACCCCGTGTTGTCCGGGTCTAAAGTGTCGAAAATGAAGCGTAGTTTCTCGTGGGCGTTCACTCCGAGTTTCATCACGGCGTCAATCAGAATGG
CATTGCCATCGATCGTGCCGGTGCTGGTAGCGTAGCCGTCGAATTCATTGCCGTCCACTTCAAAAGCCTGTGAGAAGGTCTTTCGTTCGATGTAGCCATT
GTTATCCGTGAAATTGCCCATAGCGTCACGAAGCGCTTCGAGTTTCTCCATGGGCGTGAACGCCTTCTCGTCCATACTCATGGCCACGCTATACTTCTGC
TCGAAGTTGCAGTCGCCGGGGATTGGCACGGTCACGACGTCACTTCCGGGTGGAGGGCCGTACATATCGTCCTTGCCTCCGGGTGGCGCGACGCGGCATT
TCTTCCGGGCTGAATTGAACGTCGCTGACATACCCGAGACCTGAGATGCTGATAAACTTTGACGAACCGTGTTCGAGCGCATCATGGCGTCCACATTGGC
TCGGCGGCGACGGGAGCGGCGGTTGTGGCTCCTGCAGTTACCCACTGCGTGGGTCGAGGTCGAGTTCATCGACATGAACTGGTTGCTGTCCATGAAATTG
GCCGTCGCCGGCTTTTGGAGCGGCGGATTCTGGTTCATGTTGATCATTGTCGACATCATTGGAGTAGTTTTATCGCCAAAGCGAGGGGCATTGGGCGACG
GCGTGGAGACGTCAATGAGCGCCTGCGTCTTGGCTGGGGTGATTTTTAGGTCGTCTTTAGGCTTACCACGCCCAGGCTCTTTCCGAGTGCGATCCATGCT
TTGAAGACGCACTGCAAGAAGCAAAATGGAGAATGAGAGCGGTGGGATGCCTGTTATCGAACCGAAGGCGGCACCACTTTGTCGCCATCCCAGCGATGTT
TGCCGAACGGGACGGCGATGGTGAAGGGAGGGCGGCGGCTTGCACGCATGTTCTGTATGTAATTTCGGTCAACTAGAAACGCGCGGTACGGCTATCCTTC
ATGCAGTGCCAACATTGGGCTCAACAATGGCGGTGGGTCTGCGCTTCGGGAATGTATCGATCCTCTACCTGCGTTTTACACGGACACGCTCAAGCACTCC
ACATTTTATTGATCGAGTACATGTATGTCATTGTAGACCATTTGCGATAAATAAATGCAGATCATGGTTGTTTGCACATAACGACGAGAAACACCACAAA
AACGCAGTTCGACAACGCTAAAGCTGCTTGCGACTCGCAAGTTGCGAGGCAGTTGTTCCCCAGCCAAAGCACCACCAAAAGCTGCACCCGAGGTATCAAT
TGCTCCATTTTAATCATGCAGAATGCCCCCCCCCCCCCCTCCTCTCTCGCTTTGACTCAAAACTTTTGATCATGACAGCAAAGACCCTTGCAGCAAGGCT
TGCTTGCCTGCCTCACTTTCTCGGTGAGCAACGATGGGCGATTTCGGGATTGTCAAATGCCGCGGAGCCCTCGAGTGCGTAATTCGACTGCAACTGCAAC
GGCGTCCTCGATCGCGATCCCCGCGACAGGAAGCCCCGCAATAGTGGTCCACAATTTGCGTTAAACTACAGAAACACGCAGGGGCCAGGATCAGCCCGTT
GCCTTTCCCTAAGCACAGCCGAAGATGCCCATGTAAAGATGTCTGAATGCGTTTCTAGTCGCGGTCGTTTAGCGTTTTGGCTCAGTGCACCCTCGGGAAA
GGTGGCTTTAGTCGCGCGAGCTACAAGGTCAAGCGACCGAGTCGCACCGATTTGTGTCGCCGTTTGACCGTCAAACTTTGACGAGTTCCCAGACGCTGCA
TTCGAGTACGGCATCGTCCATTGGTGATGACCCAACGCCGTTGGCAACGGAGCCTGTGCGATGCAACGTACAGCCGGGACAGCGGCAACCGACCAGTGTA
TCCTGGGACCATTTCGGTGCGCTTGAAGCACGATTAACAAGGTTGGTGCTTGATTGCTGGCAAAAACAACATTCAGAGGATTTTTGATGTGGAAGTTACT
CCTTCGAACTACTAAAGTACAATGCAAGAAGCAATACTGAGCACGCTGAGGTAGAAGTTGTTGCAACGCTGTGACTGTAACTCGTCGACAACTGCAGAGA
CAAACAAGCCGGCGATTGCGGGGAGCTATACTATCGATTTCCTTCCCACTGTTTTCACTACTGTACTGTAAACTAACACTGCTTATCTCGCTTTTCTCGA
ATCCGTCACGTTAAAAGTTTAGTTTAATTGCATTTCAAACATCAAGCAAGCTTACTTTAAAGGGACTGCGGCTATTTTGTCGAGCTGTTGGCAAGTATTT
CGTGCGGTCAGAAGACCGAGGTGGTAACCAGAACCCGTCGAGTTGCTGATGTACTGCGTTGTGAGAAGGAAGCATTTGATGGTCGGTATCGTACCAAGCT
CCTGGCGCTACACTGCTATCCGTACAGGATGACACACCTGGATCAAAATTGCTGGTCACCTGTTCACTACTGCACCCGAAGCTTTGCTCTTCCTCATCTT
CTTCTTCTTCCTCTTCTTGAAGGGTCAGTTCGTGAATTGTAAGCGCTTGCTCTTCGATCTTCTTTTTCAGCTTCTGTCGCTCTAGCTGCAAGGTGTTAAC
TTCTCGCATCAGTTCGCTTTCGTTGTCGCCCTTCCAAGATCCTTTTTCATCTTGAAATTTGGCCTTCAGTCGAGCTACTTCCCCTCGTAAAGCCTCACAG
TCTTGACGTAAGCTACTAACAAGGCTAGCGTGCTCGGACAAGACGAAATCAGTTGCTGGGCCTGTGGATAAATCACGATTTGGTGACTCGTTCAGTTTTG
CTGGCGAACCGTTGGTCCCGTTCGTCTTCACTTGCAACAAGTCGTCGATAGTGTGAGCCTGCTCCTACAGGTGATCAGAAGTCAGTGAGTTTTCATCTGT
AGTTTCTTTTACAACACCAGCCTTCGACTTACCTCAATTAGCATGTTCGCACTCAGCTGCGCCTGTACAATTTCGTTCCAGTGCTTTGATTTTTCCTGCT
TTAGCACTTCGTACTGGGCGACGAACTCTTCGTATCGACGCGTAAGCTGTTCGTGATCTTGAGTGATAGATTGTTTATCCGCTTCGAGGTTACGAACTTG
CTCAGTCAAGCTTTGGCGCTGAGCAAATGTTGCAAAGTTAGATCCACCGAGTGTTCGCTTGATAAAACGTAGCATACCTCTTCCAGACGAGCTGCTTCAA
GCTCCTGAAGTTTCTTGCTTTGGTCTGCTGTCTGTTCAAATACACGACCACCATATCGTTGACTCTCTTGCTGCCAGCATACACATTTCAGCATTCAGCG
TTCTTACCACCGCAGTCAAGCTGGTCAAATTCTCGACCAGGTCCTGCATTGTTTTCTGCGTCACTTCCATTTGCTGGCTTTCTTCCTCTCGCTTTGAATC
CGTTTCTCGTACCTTCGCTTGAGCTTCCTTCAGCATGCTTGATACTCTCTGTTCCTTTTCCTGAAGTTCCTGGTGCTGATTAGTTACTGACTTGCATTTC
CCCTGTAGCACTTCGCATTTTTCGACAGCAGCCTGCAATTCTTTGCATGTATCCAAGTACTTTGTGTTCATTTCTTGGAAGCGATCCCAGCGCTCAAGCT
CCAAGTTCTTGGTGACTTCAAGCCGCGTCTGCTCACGAACGGCATCCAACTTAATCTGATCGTCTTGTTGCTTCTGCTCAGGGGTCTTTAGACACTGGGA
GCACGTTATGCTCATCTTTTTGTGCTTCTTCTCGATCTCCCAGCACTCCTGCTCCTTAGCCTTCACCATTTGCTCGTGTCGTGCCTTCATTTGTATCATG
GCCTGGTAAATCTGCTCGTTTTGCTGTTCGATGCACGTACGCGAGCGAAACAAACCACTGTAATCTTCTTGTAGCATCATTAGTTGCTCCTTGGAGTGCT
GGTGATTCCGAAGCACCTCCCGCCACTTATCCTTCATATGCCGCACCATCAGCGCGTGCTCAGTTTTGATCTCACTTTTCGCGTGAAGCGCTTCTTGCAA
CGCCATCGATAAATCTGCAACCTTCCGCTTGTAAACGGTGACTTCACCTCCCATTTTCTCCTTCAACTGGAAGCTTGAGCGCTCGCGATATCGTGCATCT
TGCAGCTCCTTGTCGACTAGCTGCAGTCGCGTCTTGCACTTTTGAAGCTCGTCCGCCATTGGGCGGTGCACATTTTGCCATTCTTTCCGCTCCGTTTCCA
ACTTGCCCCTCAACTGTTCAACTCTAGCGCGTAATGCCTGACGCTCCTCTTGAGTAGATCGAACATTGGACGCAGACTCGTTTTTTACCAACTCGACCGT
TTCCTCGTGCTTTTTCTCCATGGTACGCAGCTTCTCGCTCAGCCTGGAAACCTTCGTTTGATCCTCCTGTCGCTGGTCTAATGCCGTCTCAAGCAGTGAG
CTTGTGTGTGTAAATTGCTCTTGGAATTTAGTTCGTTCAGCTTCTACAGCTGCCATTGCTGTTTGGAGGGTAGCGATCTCGCGCTTGAGCTGGATCGTGT
GAGCGCTCGCCGCAGCCGCCGCACGAGCGGCAACCTGGTCCTTCTTCACCAACTGCTGTCGCAACGTCTCAAGGTCACGCAGGAGCGTCAGTCGCTCCTG
TGTAGCAGAACAGATAGCAAATAACATTTAAGATACAAGACAACTTCAATATGATATCCGACGGTCGTACCTTGTCGAAACAACGCTGAGCGTCCTTCAA
GGACAGCGTGGAGGCCGCGACCATGGCTTCCTTGGCCATGTTTCAGCGGAGGAGGTGGCACCAAGCCACGCTCAAGTGCAAGCTAGAGCAGTTGCAGCAC
AAACTTCCAGCACACTCTATAAATACATGTCATGTTTAAACTTGTATGAGCACTGCAAGAAACGAATATATTCGAATATTCCAAATGAGAGGTATTCTAA
GACTTGGGATTACTACGGAGGGGATTGCAGCGCCAAAGTATCTGTTGCGTCAACGATGGCGCTGCGTCTGCGCCAACTGCAGGTGGTGCACCGCCATGGA
GACCGCACCCCGTTGATCAACATCTTTAAAGGGGCTGTCAATGCACGTTACGAGGAGGAGGAGGCGCTACTGTGGGGGGGACATCTTCCAGCGCCGACGC
AACTTGCGCAACTCCGCTCCAAGTTCAGTGTGCACATGGGCGGCGAACCCCAGAGCTCCTTCCAGCAGCGCCCGTTTGGGTACTTGACGACTCGAGGCAT
TGCACAGATGACCGAGCGTGGTGATCTACTTGTAAGATACAAATTAATCTCTGGAAGCAACGATGGAAGTGAACTGATGGACTTGTTTGTCGGCGACAGC
GAGAGTTCTGTGAGAGGGAGGAACTGCAGCTAGATGAAGTGACTCCGGAACAGGTGCAGATCTTCAGCAATGCGTACACGCGCACACAACTTAGTGTGCA
AGCGCTGCTGGATGGTATGCTACGCGACCAACCCCAGTTGAGCCCTCCAGTGAGCGTGCTTCCGCCGGAAAAGGATATCATCAACAGTGCGTTTTTGCGT
GGTTCTTCCGCAAATTTAATAGTGAGCTGATGCTGTCTGTACATGTGTGCAGCTTATCCGCTCTTCCCGGAAATCATGCAGATGAAGGCAGAATTGGAAA
GAGACAACGCGGAGTTCGCAGCGCGAGAGCACGACATGATTCCGGTCAAAGAGGAGTTGAGCAAGCTGTTTCCGGCTGTAGCCTCGGGACAGATCCCTTT
CACCTGGTTAACTGCTGCCGACTACTTCGTCTGCCGTCGTGCCCATCAGGCCCCGTACATTCCTGGCACAGAAGTGCACGGTGATGTCACGGAAAAACAC
CTCGGCTTTCGTTTCCACCAGGTAAAAAGAATATCTGCTGGGAATCATCTTGGTATCATAGTGGTAGGAACTGACAAAGCGTTGTGGTTCCTGCAGTTTT
ACTCGCACCGGACGATCTTGAAACTTGTGGCCGGACGCTTGATGCACAACGTGCTACGTGAGGTGGGTCAATTTCGCGCTATTGCTGCACTTTGAGTAGA
TGGCTGAAGTCTTATGCATTACATTGCAGATGCAAAAAGCTCTCTGGGACCACAGCGAAAGGAAGAAGATCGTGATTTACAGTGGGCACGACGTGTCGCT
GCTGTCTGTTCTCCGTACCATGGACGCTGCAATTGCAAATGACATCAGCTTTTGGCCCGAGTATTCGTCTGCCATCGCACTGGAACTACTAGAAGACGAG
GACGGGAAATTCTTCGTTCGTGTTCGACTAAACGGCGAAATTCTCGCTATAGGCGAAAGCACAGACGGCCTCTGCTCTCCTGATCGCTTCCGTGATATGG
TGTCGGACCATACGGGTTAACTTGCCTTCAGAACAACTCTGGAAGCTCATCAACCGAACCAAGATTGCAGAGTGCAAAGCAAAAATAGACCTTTGTTTCT
ACAGCAGAGCAGTTAAGCGAGCAGCTCGGCCATTTGCAGGGCACGCTTGTAGCGTCTCCGAGCCAGTTTAATACTGAGCAGTTTTTCCTTTTCCTCAGCC
GCTGCCTCTTCCTCCTCTTTTGCTGGAACACCAACGTCAATGATTTCTTGCGCCGACTCCATCACACGCTGCAAAAACCGAATGTCAATGACTACCATGC
TTCAAAATCCCCAAATAGTTAACGAACCTGGCGTGCAGCACCCTGAATACCATTGAGATACTCTAGCACAATGGAGAACATGGATTTGGGCACAACATCA
GCCTCGTACATCCAGCGGAGAATCCATTGCTGTTTGATTTTCTGCATATCATAACGCAATACACACGCAAAAACACAATGAGTGACGGCCCGACAACAGA
TTAAACGACCAGTTCAACGCACCTTGAACTTCCAGGGCAACTCGTCGTCGTTCTTAAGCTCGTCACGCTTCTGCCACTGCTCGAGGTAGTATTTGGCCTG
CTGAATCATCTCCGGAGAGCGGTCAGCCTTGCCGCCACCTTCCTTCTCTTCCTCTGCATTCTTTTTCTTGAACATACGCGCACGTTTCTTGGGCACCACC
TTCTCTCCGTCATCATCGAACTTTACATGCGTCTTTGCCGGTTCCTTCTTGGTCTTGGCGGCCTTCAGCTTGCCGCGCTGCTTCTTGGACGGCTTGATGG
CGGTCATGTCTTCGTCAAATACGGCGTATCGCCAACCAAATTATGTCGACCATCAAAACGAAACAAAACACTCTTGATTGGTGGAATCTTATTTTAAGAG
CTTTTGATTGGTGGGTATTTATACCGTGAACAAACCGCGCGGAATTGAGCTCGCGCCAAAAATCTCGACAATGCGCGTGACCTCATCGCTGTAGACGCGT
CAGTTCTCTTCTTGCGGGCAACAGGCATCGCTGCTATAGAGACCCATCACTTGATGCTCATTGTTGCACTATAGAGTGCCAGTGTCGAGAGTGCGGATAT
GTGTATCAATCGCAAACGTCCTCGCACTGAGCAGCTACGGAGTCCACCTCCAACATCCCAGCAGCTCGACGACCAACTGAAGCGCGTCAAGACTGATTCG
CCGACATCAGTGGACCATGAGGGAATTACAGACAATCAGGAACCTGACAAGGAGGAAGCAGCGACGGCAGCGCACCGCGATGAGATGGTAGCAGCCATTT
TGACGATCACGTCGGCCTTGGGGCTCTCGAGGGAGACGCTGCACCTGTGCATCGGGTTGTTGGACCGATATCTGCAGCTTCAGAGCGTTACGGTGTTCAA
ACTTGAAGCTCTGAGCATTTCGTAAGCGTGCTAAACTGGCTGAGGTTGCTGTGAAAAACAATGTGCTGACGTTCGTGGTTGCAAAATGTAGATGCTTGTG
GATCGCTGTCAAGTTTGTCGAGACGCCGACAACTATTTTCGACAAGAGCATCAAAGAGATTCTGCAGCGGCGGAGGCACTCTGGCAACGTAAGTGTGAAA
AGACTCCCGTTTCGTGTGATGTTAGTACTAATGGCTCTGTCAATTTACAGTGGACATGGAACGAGATTCTCGCCTTCGAGCTCAACGTCCTGCAACTTCT
CAACTTTCGCATTATGGCGCCTACAGTTCTGGAATTGCTTCAGAAAAGGATGTTTGCCGAAGTCGACAGTGAGAACCAGAAGCACGACCTTGATGGCTTG
CGGTTCGAGCAACACCAGCTAGCGCTGTATTTTGCTGATCTCTTGCTACTGAAGGCGCGAGCAAATCAGTTCCCAAAGGAACTCCTCGTCGACGCAATAT
GGTTTGTCGTATCGGGCAACAAGATCGCGGATGTAAAGCCACCACTGCTAGAGCCCGTCGTACAGCTCTATCTTGCGCACCGTGACAATATTAACCCGAG
TCACGCTGTTTTCAAGCCTTGGTTTGCGCTGCGCTGCCGCTATGGCGCCTTCCTGCCCGCTCCATGGAAAGTCCCCTACGATCCGTCCTGTGTATGCCGC
GTCTGCGAGCACGCACAAGAAGAACTCGCGTCCTGATGTGTGATGGATCCTTCACAACACTGTCACTGGCTCACCCAGTACAAATTCAGTAGAGCTAATA
GATGTACCATACCAAATCCAATCTCACTTTACCAGCGTTGCACATACTTCAAGTAGCCCAGTACTATGCAGGTGCCAAGTCGACAATTCCAAAAAACACG
AATGCGAGCTACCATTTGGCCCCCAGGCGATTCCATCTCCTAGCTGTATCTGCACGTTGCCGTCTCTAATGTGACCGACAGACGGCGTCTATCACCGGTG
CAACTGAGCAGGGGGTAAGTCTCATGGCGCCTACAGGAAGTGCGTCTTGCGAAGATCCTGGTACTTCTTGTACCCGGCAGCGACGACACCGGCAATGATG
AACACGATAATGAAGAACGGAGTCTTCCAGCTACTGGACTTGGCGGCCGTTTCTTTCACGGTTTCTTCGAGCTGTGTGTCCACCTGATCGCGGATAGCAT
TCACTGTGCTGTGCACACGCTCAACCACCTTTCCGTTTGCCCAAGCCTCCAGCTCATCAATACGTTTTTCATCCTCAGTACCCTGTTGCTTCAGCTTCTG
GATCGTGTTCTCCGTAGACTCCTTCAGAGCAGTGAACTGGTACTCGAAGTCCTCAAGCAGCTGAGCGTACTTCCGCTTGACCAACTTCATCTTGTCATCG
TTGCTTCCCTTGCTGAGTGTAGCTTCGAGGTTCTTGTCCACCGCATTGCGTTGCTTCTCGTCTTCTTGGGCTGCGAGCGAATCAATCACGTCACTACAAG
ACACCATAAAGTAAGTAAATAGTCTCGCCACCTCCACAAAAGCCAGAACCTGTAACCTAGGAAGACTTACTCGTAGACGTTGAAAGCGATGACATCGTGG
TTGTCGGCCAGACCACCCGTCGAGGCCGAAATACCGATGTACGCGTCGTTCAGCCAGTCATCGCCGATGCTCAGACGTTGGCTGTAACACTTGGCCCAAT
TGCCCGAGGCGTCGGCGTCGATCAGGATCGTAAACTGCTGGTCCGCCTGCGTGTACGTGACCTTAGCACGCGACATGTTGAGCGATGGACTGAAGGCTGC
GTTCTTCTCGTGGTATCGAATGCCGGGGGCCATGCAGCCCACCTTCTCCATGTCATTGAGCTGGTCAAGCGTCTTAGTGCCATCGTTTTCGAAGAACGTC
ACATCCTTGTGGCCGCCGCTGTGCTCCTGGTTGATGAACGTGTCGAACACGACGCCGATGCCCTTAAATTCACCGATAAAGCCGTGGTTGTCACCCTGCA
CATACTGACTAGTCGTGAGCCAGAGCGCCAGGCCGTCGCCGAACCAGGCCTTGGCCTGACCGCTGATACGGAATGTGAACACGGCAGCGAACTCCTTAGC
TGCCAGTTTTTGCTTTCCCCAGATATGGCCGCGCTTGCTCTGGCGGTCGGGTGTCAGACGAGCGAAGTGGCGGTTCACGGCCGTGTCGCCGCCATAGATA
TAATTGTCTCCGATCTGGCGTAGTCCTTCACCGTCAATGTTGTCGAAAGGTTTGTCGAAGGAGACGTGGTCCAGGCGCTTCGCAATGGCAGGAGAAGACT
GCAGCAAGGCCAGCAGCGCTGCCACGCACACCAGCAGCACGCGAGATACGCTCATGGTCGAGATGTGGACACGCGGAAGGAAGGAGCTGGCTGACTCTGC
CAGGTCCGTCGGACTGTACGATTTGCTACGTGGCGATGATCCGGACCAGACCGAAGACAAAGTACTGAAAACGACATTTTAAGTACGAAATATATTACGC
ATGTAGACCTAGCCACATGGTGGTATATTTCAGGGTAGGGTACCGGTAAAGTTAAATAGTTACGCCTGTGAGCACCGATTATTTATAATTGACTATGCGC
ACCAGTTTTCATTTTATACTTCAGAAGTACTTTTTTGCCTGGACAAATATCCTTTGGCGCGCAAACCATGTTCAGCTCCACGTCGACGTCGAAGTCCAAT
CTCCCAGCGCCCGTGCTGCCTTGGGTGGAGAAGTAGTACGTTCATGCCTTCTCTCTCTTCCCATATATGCTCGTAATCTTATGGTTATTCCTTGCTGTCG
CTGTCCTCCAGCCGTCCCAAGAACGTGGACGAGATCTCCCACCAAGAGCACGTAGTGGCCACGCTCAAAACGTCCATTGCCAACGGCCAGCTTCCTCACT
TGCTGTTCTACGGACCACCAGGCACAGGCAAGACGTCCACGATCGTGGCGGTAGGTCGCCAGCTCTTTGGCCCGGATTTCCGCAAGAACGGCCGCTTCCT
AGAGCTGAACGCGTCCGATGATCGAGGCATTAAAGTAGTGCGCGAGAAGGTCAAGAGCTTCGCCCAGGGAGCCATCAGCAGTGCCAACGGCCTGCCGCCC
TTCAAGATCATCGTGCTGGACGAGGCCGACTCCATGACGGGAGACGCGCAGTCTGCGCTACGTCGTATGATGGAGAACTACTCGAAGGTCACACGCTTCT
GCCTCATTTGTAACTATGTGAGTCGCATCATTGAGCCCGTGGCCTCACGATGCGCCAAGTTCCGTTTCGCCCCACTGGAAAAGGTCTCCATGGCCTCGCG
TGTGCGCTTCATCGCCTCAGAAGAGCACGTTAATGTGCCGGACTCGGTACTGGATTCCTTGCTCGAGTGCTCAAACGGAGACTTGCGTAAGGCGATCAAC
TACCTGCAAAGTGCCAAGCAACTATGCGGAGATGACGAACTGTCGCAAGATGATGTAATTGCAGTGGCAGGCCTTGCCCCACCAGAGCTACTGAAGCAAT
TTTGGGTCTCACTGGCTTCGAACAGCTTTGAAAAGATGAAGACGGACATTGAAAGCATCCTGCTCGCCGGATACCCGGTGCTTACAATTTTGCGGCAGCT
GAATGACGATGTCCTCGCACTAGACAAGATCAACGACGTGCAAAAGGCCAAGATCTGTCTGCGCATTGCCGAGGCCGACAAGAGGCTTGTGGATGGCGCC
AGCGAGCACTTCCAGTTGTTAGACGTCGCATCCTACGCCATGCGTGTATATCATACGTCGTGATATGTGTAGGCGCTTGTCATGGCAGCGATACACGAAT
AAATAGTGGG