Description :
From Genome Similarity Track
Location :
Scaffold_7:900903- 903751
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05304exosome complex exonuclease RRP6-like protein
Phypa_INRA-310PPTG_05305hypothetical protein

Sequence
2848 bases(100 bases per row)
GCAAAGCCGACAAGAAAGACGTGGAATGAGGATGGAGAGGAGCAAATGGTTAATTCCATTCGGAAGCGTGTGGGACGTGCTGAGTATGCTCCTTGGAAGA
GTGGTCAGCGCAAGGCTGGAGTCGCTACTGCTGCTGCTTCGACTGGATCTTCATCATCCAGCTACAATCCACCGATGGCACTCGGAGTGAACGTTTCGGA
GACTGCCAATGAGCCAGAGACGGCAGCCACGCTGCTCGAAAAGGTGAACGCTATGGTTGCGAGCACAATGTTCACTATTACTGAGAGTGACCCAGTCGAG
ACACCAGTCAATAAACCGACGTCCTTGTTGGCGACTCCAAGCAAGGAAGAGCAGAGTGTCGACGAGAGCAAGCCGAAGATTCCTCAGTCTATTTCAGAGG
CCTATAACATGTCGAACCGAGTCAAACGGCGGAAAACTACGGCAGTGGACACGTCGTCGGCCTCTCAAGTCAAGGATCGTGCGCAGGCGTTCATGCAGAA
GGTCGATGGCGACGAAACTGAAGACGAGAGTGGCTTCAAGAGCTTCGACTATGCTGCAGCCAGTACTCAGATCACAGGAGCCAAGTTCCAGCTCAAGAAG
GACGAGGACGAAGACCGGAATGGCCGCAAGGGTGGCCGTGGAGGCAACAAGAAGCAGGCAGGTTACAACCCGTTCGTGGCAATGAGTGGCAAGGGGAAGA
AGGACCCGAAGGAGCCCAAGGCCGCACAAGCCAAGAAGATGCACCACATGCCGAGAAGCGCCACGTTCAGATAGATACAACGTAACTGATCAACGGTAAA
GCTGGCCATGCCACAGTTAGATAGACCCCAGTCAATAAACATGCTGTCACCACCACCAAGTCCATAGTAAAAATTCCTTATAATAGTTGAGCTCTGTCCG
GTTGAAAATTGCGACTTTTGTCTTTTTCCGACAAGGCAGAGACAGTTTCACAAGGACAGACGGTCAAAAACTTTTAGCGCCATTTTGGAAAACAAGAAGC
AGCGGACGCGATCTCTCGATGGCTCGTAGCGACTCGCTTAAGCGCGTCTCGCCCACGTCGTTCGAGTCGGATGGAGGGGAAGGTGCCGCTAAGAAGAGCA
AGACCTCAGTAGACGTTGCGAGCGAGGCGGCAGCTACGGTGCGCAACGGTCCGCTAGAAGCGGAGGACATTGGGACAGACTTCGACGTAGGGGAAGACGC
CCAAACGTCCGCTTTATCGACCAATAATGGCGTTAACGACAAGCAAGAAGGCGGGGAACAAGGTAAACGGTGCTTCAGCTGTATTTTCACGCGCTTTAAA
GCATCGAAGGCTTCGTGGTTATTGACTTGTTGATTTTTTTTTACTAAACCGTCTTACAGTCGTGGAAATGGCTGATGCCGAAGCCTCAGAGACGCCTGAA
ACCAAAACGAGCACGATAAATAATGTAGCCAAGTCGTCCTCCAAGAAACCAGTCAAAAAGCGCGCGAAACCTTTTGGCAAGGCAGCAATTAACGGGAAGA
CAGAGGCTAAAGGCTCTGCTAAGGCCAAAGCGAAGCCCAAACCCAAGACTAAAGCGAAAGCGGCACCTAAACGGAAGGTGCGGACACAGGGAGACAAAGT
GAAGGAGAACGCGCCACTGGCCACGCCGTTCTTCGTGGAGACGGGGGCCGAATGGAACAACACGAACATCGACTTTGACGAGCTGAATACGCTGAGATCG
ATGTGGGAGCTGCCTGCTGCTTGCCACATTCTGTGGCTGCTGCAAAGTCCTCTGACCCTTCGCTTCTCCAATACGTTGCTCGAGTATGAGGCAGCATTGC
TGAAACCCGAGGACAGTCCCGTACTGGAAGACGTGTTCACGAAACTCTTGCTAAAGAAAAGTGAACGCGCGTGTCTGAGTGCTGGCATTGGACTGAAGTA
CGAGTGGTGGAACAAACAGCTGCGGATTTACTACCTGGACATGTACAACAAGTGGTACGCACTACTGCGTAAGGCTGGCGAGCGACTACCGGAAAGCTTT
TCACAAGATGAGGACGATGAAGACAGTAGCGGCTCGGAAAGCAGGACCGATGAACAGGTGGATGTGGAACTCACTGATGACGAGTGGCTGACACTGGACA
TCCTGAAGGCGCGTCTTGAAACACTCGGCGTGGTTTGTCCCCTGAAGGTGAGTACAGTATCCTACGAGTAGCACTATCGTTTCATATTGTGGTGGCAACG
TTCTAACCCTTATGACGTGTGTATGGGCTATAGCACCAGTCATTCGCTGACTTGTCGATTGAATTGCGGTGCAAGATTCTCCTGAACTTGTGCGAGGCCG
TGGTGGACGACCCAGCTAACACGTACGTAGTCTTCGTTGTATGAGGCTGCGGAGCTTGACCTCACACTTTCGTGAAGTGAATATATGCGTCAGATGGAAG
AGGACGATCTGCGCGTGGAGCCGTTGGGTAATGACCGCGCTGGGAACTTGTATTATTTTTTCCCGCAGTTCTACGAGGAGCGGCGGTTGTACAGATTGGA
ACCGGAGACACGACAGTGGGTGCTCTGGGCGAAGGGGGACGACGCGTTCCGTTCCATGCTTAGGGCGATGCAGGGCATTCGTGGACGTAAAATTCGTGGC
GAGCAAGAACTGCTGGATCACTTGGAGGTGATTGTGGAGCAGATTGAGGACGAGGACGAAGCCCGTGCTCGGCAGCTGGAGAAGGCCAATCGACTGGCCA
TTCTCGAGGCGATTCCACGTAAGCGCTCGCTGCGTCTGCAAGTGAAGCAGTTGGAGAAGATGGAAAAGCATCAGGAGGAGTTGGAACACCGGAAAGAGAT
GTCGATGGAGGATATAGCAGAAATGAGGCGTGCCGAGTTGCTGAAAAA