Description :
From Genome Similarity Track
Location :
Scaffold_305:9009- 15875
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_305-snap-gene-0.7Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_305-fgenesh-gene-0.2GRV2 (GRAVITROPISM DEFECTIVE 2)

Sequence
6866 bases(100 bases per row)
ATGGGCAAGCAGGGCCACGGCCGGCGTCTGACGGACAAGGAGCGCATGGAGATCATCGAAGTGACGCGTCAGGACCCGCGCATCAAGCACGTGGAGCTCG
CCGCGCGCTACAACGTGAACGAGTCCACGATCCGCAAGTGGCGCCTCTCGGCCAACGCCGAGAAGATCGAGACGCGCTACGGCCTGGGCGTCGAGGACGT
GCGCGACGCGCGCCAGCGCGGCCAGGCCGTGCGCAATGCCCAGTTCGACGCTGCGCTGCACGAGTGGGTCGCGAAAGCGCGCACTGCGGACGCTGAGCTG
CCGCCGTCCAAGATCCGCGAAAAGGCCAAGGCGCTCTCGGCGCAGTTCGACGGCATGCAGGGCTTCAAGGCCTCCACCGGGTGGTACTACCGCTTCTGTC
GCCGATATGGGCTCCCGTGTCCGCCGGCCAGCGGTGGCGTCAGGAGAAGTGTTGCGACTGCTGAGAGCGAACTGGCGGCGTGCGCTTCACTAACGCCGAA
GAGCGAGGATGGAGCGGTTGCATCGCCCGAACCAAGGACCGATGGTGTGACCCCTGCTGCCCTGGAAGCCGCGTCTCCGCACGAGCTGCTTGCACGAGAA
GGAGACAGGGAGGACAGCCGTGAGCTTGAACAAGAGCAAGATATATATCCAAGTGCGGCGAAGAGCCCTGAACGAGAGTCCGTGGTCCAGACCAGCGCAT
TGAGTAGCGCTGAACGAGAACAACCGGTCCAGACAGTTGCTGCAGAAAACAGCTCAACCGCTGCTGCATCGCCGACCAAAGCCCTAAAAAGCACACCACG
AACGCGATCTAGAAAGCGCAAACACGAAGACGCGGTTGTTGCTGAACTGGAGAGAGAGGAGCGTGTGGGTAGTCCTCGAACACTCAAGCCCGTCCACCAC
CTAGCTTCACCACCTCCACCAGCAGTAGCAGCAGCAATAGCTTCACCGCCACGATCCCCACCTCGTCAACCAGCAGCAACAGCAGTGTCCCCACCACCTC
CAGCAACGCCAGTCACAGCTGTGCCAGTCGCTTTGCCGTCGCCGATGACGTCACCGACCGTGCTGAGCGCCCGGCAAGAAGTGATCGCGCACTTCCTGCG
CCACCACAAGAGCCTGCTGAACGTTGCGAGCCGCTTGCGGTTCATCAAACACCTCACCCACGCGCCCGAAGACGTCGAAATGTACGCAGTCATGGACGAC
GAGACCCGCATCGAGTACATCAAGGAGTTCGCAGACAAAGGCAGCGGTGGCGGTCCCGCTGGTCTATGAACGCTTGATAATTTTCCTGCAAAGCGCAGTC
GTGACTTGACGTGCGTACTTGAGAGGAAGGCAGGAGAACCCGAGCCAATACCAGCAGCTCCACAAGAGCGGTGATGAAGAGCTACTGTGCCATATGCACA
ATGAGTGGCCAACCAGCCACCATGGCCCGCGTGGTGCGCTTGCAGTGGCGTGATCCAAGTCGCCGTTCTCGTGAATGGAGAGAACCCATAACAAGTGATT
CGGAAAAGAAATCAGGCATGCCCACTGCGAGAGATTATTTCAACCGTCACTCTTCACTTCCACAAGCCATAATCTCATATGATTCTCATCGTGTAAACTA
ATACCCTCTTACAAGCATTCAATATCGTTTTCACAAGGGTTTGCTTGCATATATAGTTTTTGCCAAATCAGCGAGATAGGTTACAGAAAGCGAAGGCCGT
TTCGGCGCATATGACCAGCAGCGGCAGCGGCACTGGCAGCAGCAGCAGCGCGACGAGGAAGCAGCAGCGAGCGATTGGTTTCTATTTACTCACGCGCGCA
GCACATCCGTCTCATCGGCCGACCAATTAGGCAGCAGCTCACGTGTCCACGAGTGAGCTCTTCACTGCGTCACGCAACGCCACGAACAGCTCAAGCGAAC
GAGCCCATCGCAGCCGAGAAAGAGCAGCAAGAGAGAGAGACACACTCGCCATGGGCCAAGCTGGGTCCGTGGAGCAGAAGAACGCGGTGCGCGATGTCGT
GAGCATCAAGGTCGGCCAGCAGATCGAGAAGGAGGCGACGTTGCAGGCGCTGCAGACCTTTTGCAAGATGTTCCCCGTCGAGGTGCGTTGCTGTAGACCA
CTACGAGGCGCGTCTTCAACTTGCTGACATGTGTGTGCGTTTGTGTGTGTAAAATAATAGCAACAAGTCGTGAGTGAGGAGGCGTTTGACGTGAAGGACC
GCAAGCTCTTTGACGTCGTACACGCGCTGCTGCAGGAACAGTCGGAGCGCACCGAGAAGAACACGAACGAAGAACTCGTGAGCCCCACAACTTGTACCAT
TGGTTTACTTATTATAAACAGCTCTTAACGTAGTTCTTCGTGACTGATGCTGTATGACAGATTGAGCAGATCCTCGTGAGCTTCAAGCGCGTGATCATGT
GGCGCGAGCTCTACCGTATGTGCGCCAAGTGCTCCATGAAGCCATTCCTCAACTGCTTGGTACGAATGCTGCCTACTCAACACCTCTTCTTGCCAGTGGC
TCACTCATTTCTATTCTTGTATGCCACCAACAGCGCTTGTCCCCAAGACTGCAGCTCTCCGTGCTCGACACGCTCCTGGCCATGGTCACGGCGTACCCTG
GCATCGATATTAACGAGAGGACCGACAAGTGGGAAACGGTTAATCGCCGGAACTTTGGTGATGGCGGTGGCTACGAAGTACTACGTGCGCTCATGGTGCA
GTACAGTGCCGAGCCGAGCCTCTCGCCCGAGAAGGAGGCGATACTCAGTCAAACGTTGCAGCTTTTCCACCTCACGCTCGTGTCCAGGAAGAACACAACG
GACCTCTTGACCTGCAGCCAGGTACAGATATTTTTTTTCTAGTGAATAATCTGTGGTTGTCTGATCTGATAGTAATGACCACTTTATTTTTTTTAACTTG
TAGGCGGTGGGCTCGCTCCTGAACGCACGTATCTCGCTGCTGGACCTGTGCCACCACCCGAATACCGAAATCCAGGACTTCGCGATCGATTTGGTGAAGG
AGCTCTTCGTGCTCATCGACCTTGAGCAAGTTCACGAGCTACAGGAGTCGGCGCGCGAGTACGGTTCGCTCTTGTATGCGCTCTCCACAGCAGTCTCCGA
GACGGTGAGGCTTTTTAATTTCAACTATTGCTGGCTGTTGACCGAAGAATCGATCAAGACTAAATGACTGCGTCTGGTGTTGTCTATGCAGAAAAAGCCT
GATAGGAAGAGTGACCAGGATAAAGCTGGCAGTGGTGATGAAGATGACGACAACGGACAGCTCACGCCGACCAATTCTGCACGTGCGCAGCAGGACAAGT
GCATCGACTTGGTCGAGATGTTCTGTGCGGGCAACACGCGCTCGAAAAAGGCCATGTACCGCATCTTCCCCGTGGAGCTCTTCATCCCAGCGGAGAACCG
TCTCGATCTGATCTCGCGCCACACGGCGTCCAGTGCGTTCAAGGCCACACGCACGAACCGGTCGCTGCCGCACTTCTCGTTTGACTTTGACATGAAATCC
AACAGCGACAAGCAGCGCATCAGGGTTGGGTCGATGGTCGCCAGTTCGAGGAACATTGGCACGGGTGCGTTCGAGAAGTGGCTCGGCGACGCTCGGTCAC
AGGGCGAGCACTGGCGCAACATCATTGAGGCCGTGCTAACGAGCCACGAGCGCCCCGAGCTCGTGTGGCGTGGCGACATGCGTGCCGAGCTGCGGCTCGC
ACTTCTAGCCGAGATCGAGATATTAGAGAAGAAGAGACGCCACCCGGACTCGACCTCGGGCAGCATCGCCCGGTGGGACCACGAGATGTTCTACGTCAAC
TACAGATCGATCCACAAGGAGCTCATTGTGAATGGGTACTTCATCGAGTACCTGATCCCGAAGATCGCCGATCTTGCGGACTCATACGAGGTTGTCGAGC
CCATCGTGCTCGCTTGGCACCTATCTGATCAGCTCGCGGTGGAAGAGAACCTTCAGCGACGGCTACTGTGCGTGCGCTGCCTGCGACTGATCATCCGACG
CTACGCGATGATCTTCCATGGTCAGCTGCCGACGCGCCAGGTGCTGGCGATGCTGGAGAACCACAACTTGTACTCGCTGGGCTTCGTTCGCGAGTGCTTT
TTGTTGCTCAACACGGCAATCGCGACGACGCGCAATGCGCCTTCCGAAAGCCTGAACCGAATGAGCGCACTGGTGGCGTCGGCTGTGGTGAACGTCTTAT
CCGACCCAACGCTGATCAGCACGCTGTCGAGCTCACGTGCCCACAATATCGACACGGAGGACGAAGACAGCGATGACGAGGGCTTTATGGACTGCGACGA
GGAGCAAGGATACGTCAACAACGAAAATGACGGGCTCATCCGCGCAGGGATGACGGTATTGCTCGCGATCGTCCGGCGCTCCAAGTACACGCTCGTGCTC
GTGCGACCCAAGCGCGTGTTCATCTGCCGCCTGCTGGCAGTGGAGACACTCGACCACATCACGATCTCGCTCATCCTGACGCTGTTGCAGCAACTCTCGC
TGATCGATGGCTCCACAAACGCGCTTTCGACAGTATCTTTAAGCTCTTCATCGTCTGGCAAGCCAGCGACCGACGTGAACTGGAAATCCCTCGCGCTTGT
ATACATTTTGTTTGCGAGCTGCGACCCGAACGGCATGGGCATGTGTCTACAGGCCGCCGAGTTCCTCAAGGAAAACTACGCCATGTCAAGCCGAGCGGTC
CGCGCGGCGAGCCTAAACGGCAATGATACAGGCAGCGACCGGTCTTCCAAGTCCGAGCTCCATGAGATTCTCGATGAGGCGCTCGGGTATGGTGGCTGCG
GCATGGGTCCGTTGCTCGCGTCCACCAGTCCAGAGACGTTCGCGGAGGTGTTCAATGCCCATGAGAAGCGCGCTGCCGACATCCTGTGGGGCCGCAAGCA
GCGTATCCGACTCTTTCGGTACCTCAAGAGCAAATATGTGGCTACGCCGGCGTCCAGTGAGAACCAGCAGCAAGAAGAGGAAGTGCTTTTCCCATTCGCG
CCCACTGGGGACGGCCTCTTTGCAGACGAGGACGACATTTTTGTGGGCAACATCTTCATCCGGTCGTACATTGAGGGCGACGGCCAGTTCCTGACCGAGT
GGAGCTTCGACATGTACACGAACCTAGTCAACGCGCTCTTTGGGCGGCTGCTGGACCTCGGGCGCACCAAGTCAGTCTTTGGCGTGGGTGCACCGTCGCC
AGTCAAGCGACCGCGTGTCGAGCCCTGGCAGGTGCAGGTGATGCTTTTGAAAGCACTCGTGAAGCTCGTTCCGTCGAATTGCGCGGGTGTGGAGATCAAA
AAGGAGCACTTCGAGTCGCTATTAACGCCATTGAGGCGCACGCTCCTCGGTGAGAGCGACCAGGTCCGCGGTGTTTTAGCCCTCGAGCTCTTCATCGCAA
TGCTGAGCGCGCCACAGGATCGCAGTGTCAACACAGCCGCGTGTCGACTGTTTCTAGAGGAGACCGGGCTGAGCGTGCTCGGCGACTCGCTGGAGCGCAT
GCTCAACCCCACGTACCAGCACCTACTCAAGGCAGAGAGTGGCAAGGGCATGGCGAACACGGCGCGTGTGCTGCTCTATCGAATCACCGACGTGCTCACG
ACGCTCTCTTCGCAGGCTGCGGGCATCCAGGCCATCCAAAAGAACCCGCAGGTGCTCACGTCGCTGCTCGAGCTCTCGTCGAAGAAGACGATCATGAGCT
ACTCGGAGGACGCGGCGACCGTCTGCCTCAACTGTCTGGCAAACCTTTGCTTCTACGACGAGCTGCGCGCGCTCGTGGTTGAGGGTGGCGGGCTGTTGTA
TCTGATTGAAACCAGTGCGTTCTGCCCGGCTGACGATATCTCCGAGACTCCGGCGTCTATCGAAGATGGGAATGCAAACAGCGATGCACCCGTGATCCTT
CAACGGCGACCCTCACGATTCTTCAACGCAATTCGAGGCGCAGCACTCACATTGCGAGCGTGCCTGAACGACAAGAACTTCAGCGAGGCGTTGTCAACGT
ACCAGGTCATGAAGCAATTGCTGACGCCGAGCTTTGTTCGGATCCTGAGAGCGTCGTCCGACAAATTCATCTTCCAACTGCAGACGACGGAGGACATCAA
CTCGTCGACGCTCGTCTGGACCAGCAGCATGCGCAAGCGATTAGAAAACTGCATCGTCCACGAGCTCGCGAAGGTGAAGACCGCGGCACGAGCCGACATC
TGGCCACGATGGGACCCGGACCACTTTGTCGCCGCGGACTCGTTCCGCTACCAGTACCCAGAGCTCGCCGACGAGCTCATCATCCACGACGTATACCTCA
ACAACTTTGTCGTGGCGGCGGGTATCGACCTAGATGACATCAGCATGTCGAGCTTCTCCGAGGCGCTGCTGATCTCGATCCAGAGCAACGAGAACGTGTT
GCGGATCCTACAGCAGGTACGATATATATTTTTCCCATCTCAAGTGGAATCTGTTGTCTGGTGTGGCTGGTGAAATTCTAACTGACTGGTATACTCATGT
TATTATGGACATTATGATGTAGCGAGGAGCCAGCGATCGTGGGAAGGAAGTGTCGGTGGTGGTGATGCGCCAGGCGCTCAACAAGCTCGTGAGTGCGCAC
CCGCAGCACAATCTCGAGGTGGACGCGGCGCCGCCCTCGGCAGCAGACTTGCCGCTGCCGTCGAGTCGCAAGACGTCCGGTGCGCGCAGCTCAGAGGGCC
AGACGCCTCCCAAGACCGCTCACAGCCGCACGCACAGCTTTGACACCATGGGTTCAATGGACCCGGAAGACCTGACCGTGTGAGCGTTGCTCTCCTATCT
GTATCCTGGTTCGCGTCTTCACCAGCCAGCGGACCGCGCCGCATGACACTTTCGCCAGATTCGCCA