Description :
From Genome Similarity Track
Location :
contig_15:900895- 912253
Transcript NameFunction/comments
g3542.t1hypothetical protein

Sequence
11358 bases(100 bases per row)
ACGGTCGTACACACCAAAGGACGTTGGCAAAGGATCGCGGACACCCACGTGCCATTGCCACCAAGAAATGCTACAAGAAAGCTTAGGTGGTGGCGGGGAG
TCCGCTGCTAGCGCGAAGAAAGCGTTGACACAAGCCCAGAAATTGGTGCACCTTGCTTCAGTCAGACCCAATGCGCTGACGCTGCGTGAATATCGCGAAG
GACTGGAGGTTAGTTGATGAGGAGGGGTCGGTGACTCGAATTATCATCCTAATCACTTGCGGTATTGTGTTTAGGAATGCCTGAAGCCGGAAGGCAGTAC
GGTGATGAAGGTTCTGGGATTTCAACTGGCTGGTACTGCTCCGGGTTGCTCGACCAACGAGATCTGGAAGTTTGTGTTGGAGGCAATCGTCACGGAGCTT
GGTAACTCCGAGAATCCGTCAGCCTTAGCCGCTGCAGTTCCTGTGCTTGGGCTCATTCCGGTGCCTCTTGTGCTGGGCTTTTTGCTTTCTCCTGAACGGG
AGCCCATGAACAAGCTGCGAACAATACTGACGCACGAAGACGTCGAGACACGCTGTCGCTCGATCGAGATGCTATCCAAGCTAACGCTAGATATCGCCAT
CAGTGTTACTGGTGATGGTTTGTTCGTCTTTCCATTCGAGTCGCACGAAGCGCGAATTTGCTGCCAGCAAGACGTCGAGACCATGGTAATCGACTGCTGG
AAACTGATTTTCCACACCCTTTCTTTCGATGAACAGTCCCAGACTGCGGCGTGGGCTGCCGGCACTGCGTTTACAGCCTTGACAAATCTATTTGCTCGAT
GCAGTACGATGACAGCGTTTTTTTCAAGCACTCGAGAATCTACCCGAGCGCAAGCTCCTATAGACGACGTTGCCTCTGTGATGTACAAGCACGCATTTCC
TCGAATTCGAGCGTTGGTTGTTGTTGCGCGCGCTCTTCCCATGAAACAACAACCGGATGCCATGCTCTGGATCTCTATGCTGCTTTACACTATGATGGAG
CGTAGTGGTGCGAGATGCCCTAGCATCAGCGTACCTTACGTTGAGATTGATGCTGATAACAACAATGTCGATGGTGCCGATGAAGACGATGATGAATCTC
ACGCGTCTACCGAGCCTGTTCGAGTGGATGAACTGGTGAGTGATTTGCTCGAGTCCTGGGCATTTCCTACGATATCGAGAAGAGTATCTCTGGCGCAAGC
GTCCAGCATGTGCCGCGCCATTTTTATTCTGCTGGCGCACCCTCTTCAAACACTCACCCGCATGCGATGGGGTGCGCAACTGACCAACCATCTCATTGCC
CAGTGCTACCTTGCGAATAAGAGCTCAAGCAGCACCAACGGAGTTGACGTTAAACGTGAGCTATGTGTGATGCTCGTGAAAACATTTGCGTGGCTGTCCG
GAGTCAACTGCCAATCACTCTTCGTGCGTACAACTGAAGCTATCTACCTCGTCGACCAGGACAAAGACCGCCGTGATCTTGTGCAGTCCCTAATGGACAC
GATCGCTGCACACATTGTGGCTAATCGAGATTTTCAACTGCTCCAGGGGTTGTGCACGATGACTTTCTTCAGACAACCCAGGGGCTTCTCCAGATTGTCA
CCACGTACCAATGGCTCAGAGGTGTTTCGAGCACTTTTTCAATCTCTCTCCAACACAGCAGACCTACCACCTCGGCGCGGGGCCATTGAGCATCAGGTGT
CCCAGCTGATTGCCTTGAGGGTCTTCAGAGGGCTTTTACTATTGAAACTTGGCGGGTCGGCCACGACTTCGCCCAAGGCCTATCGACGGTCCTGCGAGAT
CAGCGAGAACATCGTTTACTACACGGGCTTGCTGACATCGCACTTCCAGGGCATGCTTGCATGTCCCGAGCTCACCCTTCGTGAGTCGCTCGACTTTTTC
CAGCACGAGCTATTCCCGACAATGGACCAAATCGCATCACAAAGTGCTCGTCTTCAGATACTTTGGATTGGAGTGCGTCTTCACCGCAATTACGCGGCGC
ACGTACCTTTTGAAGTTCTGGTTCGAGAGCTACAGCACGAGACTGGTCGCCTTTTCACTGCTATCTGGAACGATGACGACGAAATGGAGGGAGCGACTTT
CGACAATGGATTGCTGGGATGCGGTGGCACTGGCGAGGACACACCTGCGAACCGTAAACGTGCGGGAGATGCTAACACTGTCGACACATTGATGGTGCTT
GGTGACTGCATTACACTGCTGGCACAATTCCAGCCCAACACGCAGCCCCAGTTTATCCAGATGTGCGAGAAAATGATCGCTGCGCTATCGGCTTCAGGAA
GTTCACCGGCAGCAACATCTCAGCAGTATCGAATGTACGTAGACCAAACCGAATTATTCCTTGCCATCGACAAGCTTTACTAATCATGACCACATTTGCA
GCATTGAGGACGTTGTAGCTCTCCTTTCGACTCCTTCGACAACGGATCTTGCACCTGAAGACCCGTATTCGACAGAGATTTTTGACCCGCAAGACATTTT
CCTGCCACGAAAGCATTTTGACGAGCATGGCGACACGACTAACCCGGAACTTCCTCAGGATGAAGAAATCGGGAGCCGGTCACTGTCACGGGTAGTGCTG
ACCCCGTCTCCATTCGGATTTCTCATCACCACCCGTTAGCAGGAAAGGAAGAAGTGATCTCTCTCGAGGTCAGCTGCTGCAACCTCACTACATGGCCCCT
GAGCGACCTGGAAATTCAGCTTCATCCGCTCGGAGGTGGGGGCGTTGTTCAATGTGTGGACAAGTCCAAGGAATTAAAACTGCGTTTGCTACGTACCGGT
GAGACTGCGAGCGTTGGTACAAGCGGAGGCAGTACCAGCTTGCCGCCGTTTGGCGTGATCAAAGCGGAAAAAAAGTTCCGTGTGTGCAAATTCACTCAGC
CCAGCTTTCTGGTGCAAGCGGTCTTGGTCCGAGAACCTAGTCAAGACGGTGAAGATATTGGTGGCAATCCTGCAGAGGAGGCGTTCGCTACTCCAATTCG
TTTGGCCTTTAGTAGCCCCTATGTGGTTCACTTCGACACACTCCTTCGACTGCCCCAGTCCCAGTTTGCTACCGCTGCGTACTTCCAACATTGCTGGCAA
AGGTACGACTTGACTGCAACTCTTTTTATTGCTCAAAGGTTCCTCAGTCGCCTATCGTTCACGTCTGCGTTCTAGTTCCAACGCGAGCGTTCTGTGGCCC
ATCAGCGCACAGACCTCACAGGAAGTCGAACTAAGTGTTTGCCAACACACGCTCCACTACATGCATGCTAAAGTTGCAGCGGCTCCCGAGTTGCAGCTCG
AGCTACCCATGCACTTTCACGTACGTTCTCCGCGTCATTCTAAACTGTTTCCAACCCCCGTACTCATCTCTCGTAATTTGTAGATTGCCATGCTCACTCA
GACGAGATGGGGCTCCTATGTGGTGGCATCATTGACCATGAGCCTAGACTCGAATTCTCATCTTCTGCTTGGTCGGGCGCTGGAAGTCCGGTCGACTTGT
GAAAACATCCGCGAATTTGAGAAGTGGCCGAAGGACGCAGTTCGTCTCTTTGCTGGGGAGATCGTGCAGCTCTGCAGTAGACCGGCATCCGCACTTTCTA
CTGCTTGTGAGAGTGCAAACTCGTCCGATCAGGCCAGCAATGCTGTCAGTGCAACGCCCTCCCTTCCAAACCCACCACCTCTGATCTCCAACGCGTTGCC
AGCTGCAGCCCCGGCCCCAATGCAGGTTGCAAACGGAATGCCGTTCACCGCGGCAGACCCCGTACTGCCCACCGCCTTCGCACCGGACGTGCGGTCCACC
ACGAGTTTCCACAAAGACGTGGGTGCTCCCAGTGACCGAAAGACCTCATTCACTCGCTCCGAGCAAGTCCGAGCGCCAGAAACATCCGCACAAGGCGATC
AGTGGGGGACCTTCCTCTGAAGTTGAAGGCAGCTTCAACTTGATGTAGCACAACACCAAATTCGCCGGTCGGAAGATCATCAACCCGCTTTTTCATTGGC
TAAAACTCGTATTAAATCACTTTTTCTCGCATCAAATCCAAGATGCGGCCTTCGGAGCACCAGCGCGGTACTGCCGGTGCGTATCGAGGGAGCGAACACG
CGAGCGAGGAACGCGTATACCGCCCGCTGCTGTTCCAGTCCACGGGTTATGCGTCTTCGGAGCTCTTCCGCGACTCGTATGAGATGCACTCGCGCCTGCC
GACCGCGCCTCTATTAGGAGTAGAGACTAGTGCCGCCGAACCAGAAGAGAATCAGAAAAAGCGTCATGTGTTCGAGCCACAGATCCGACTCGAGACGCTA
TCGTCGCGGGCTGCTACAGCAGTGCTTTGGGTCACGTATTTGGTGTTTTTGCTTGCGATGGCACTGCCGTATTTGCAGAGCAAAGGGTACCTGGAAACGG
TGAGGACTATTTTTTAGGACTATTTCTGATTCTTGAAGACTTTTGTGACGCTTTTTGTGATTTTCAACATAGGCGGTGGAACTGCCGGGAGGGGTTTGCC
AGACAGAGAAAAAAGTGGGAGAAGAGCCGTGCATTCAAGTGGACAAGACGAGGAGTATTGCTCAATGGACAGCGTACGTGACGAATGTGTCGCGGTACTC
TGGTTCCATTGAGATAAAGCTGGACGTTCGGGAGCAGGTGAACGCTTCAACCTCGGTGGCTTCACTTGTGGAGAGCAACACGTATCAGGAGCTGGAACGT
GTGGGCACAGCGTGGAAAATGGATCGAAAAGCAAACAGAGGAAATAGTAATTTAGAGAACGAAGCCTCGAGCATTTCGGAGGTTGCGGAAGGGGAGGTTG
ACCAAGAGGCAGGATATGTATTGACCTATGACGCCAGGCTGTATGGTATTGATCACGAGGTGACCCCTGCTACGAAGGATCTTGTAACAGATGAACGGAA
TCAGAGTATTTGGATCGAGTGCCGATCTAGCGAACCGTGTGAAGTTGTTCAACTACTGGAGATTACGCAAGACGTTGATCGACTGGTGAGAACACTAAGG
GAGATGAATCGGATATTATTTGTGTGATTGACCTTTTGGTTGTATGATATCTTTAGGGTGGAAGCGGATACGACGCGTATTTTGTCATCGTGTCTTTTAG
AGGGCTGTATCCAAACGTCTTCGGCAAGGATGTGGTTTATCAATTCGCGTACACGTACGTACAAATTGTTGTTGCTGAAGTGAGTTACGCTTATTCGGTG
AGCACTAACTTGCTAAATTATGTTATCCAGTAAGCCAGCTATTCACGTTGGCGAAGTTATTGTGCGTGGAGTAATGGTGTTAGCATCCATTTTGGCGCTC
CCTTGCTGGTTCATTTCAGTTCTGAATTTCCACGGTGGATCATGGAGCCAAGTGCTTACCGTACAAAAGTGGTTACTGGGAATTGGCGTCGTGCTCGTAC
TCTGGCAGAACCCAGTGTACGCAGTGTCTCAACTGTACACAACCGTGAGCATGCGCACGCGATTTGTGTCGATCACTAGTCAATCACTTGCGGAGGCTTC
TTTCTACGTGTTCTGGCTGAGTCTCATGGACCTACACAGCGGTGATTTCACGTCTCGAAGATGCGCGTTTACCACGAAGCTGATATTTGGTTTGGTACTT
TTCGCGGTAGATACGGCTATGACTATGCTACGATTGCCCAAATTATTTTTTGGGGCAGAGGGAGCGTCATCTGCGCATGATTTCCAGCACCTAGAGATCT
ATGTTCTTCTCGGATTCATTCGTACGGGATTAATTTTAATTTGGCTCGTGTGGATCATGAAAGTTGGTGCACGATCAGGGCAGCATTTGAAGGCGCTGCC
GTACATGGCAACTCGCTTCAAGCAACTGTCGTACCGATTTTTGGTGCTCGAGACTCTTTTAATTTTTTTCTACATCTTCGTATTGTCGGCTCTTCAGATA
TTCTACCTAACGCAAACGTGGTACTTCGTTGGTTACGACGCATTTATTCAAGACTCTATGCACACGTTTGCCAAGATGCACACTGGCCATCCGTCTCTGG
GCAAGTTTGTGTTCTTGTCGGTGTACGTGTACCTGGTGATGTTTGTACATTTGCCCCCGCTAGCGGGCAACAGTACGGGTCTGCTAGCATCTACAGCTTT
TCACGTCGACGAAAAGCCTCGCGTGGATTCGTATGGCTTCCTGACCCCCGACTCGAATTTATTTTGCGTTGAAACGGCTGGCTGGTTGCTGGAGTTGGCA
TACCAGGCATACTTTGACCCTCCTGGATGCCCTTCATCGTCTGGATATGGAGAGCTTACTCTTGAGCGATATGGCTTCGAGCTGATCACTCATCTAAGGA
GCAACTTAACGGATACTCACGTAGTTGTTGCGTGGAGTCAAGAGGATCATCGACGCTTGGTCATTTCGTTCCGTGGTACAACGAGCAAGGAGAACTGGAA
GAGCAATCTTCGAGCTGACCAGCACGTGCTGTGGATAACATCCCGAGGACTTCGCTGGAGGAAGACGTGCATCGAAAAAGTGAAGGACACTGCGGCAAAG
ATCCCTTTGCTGAACATGGCACTGCCGCGAGTTCATCGAGGTAATTACGCATATCTAGCTTTCCTTACCACAACGCTCGGGCATTTTGTTTATCTAGCGA
TGTTTGTTTTGCTGTACAGGTTTTTGGATCGCATACGAGTCAATCCGAGAAGAACTCAAGGAAGTGACACGGCTCATATTAGACGAAAACCCTGGCGTGT
CAGTGTATATCACGGGCCACAGCATGGGAGGTGCGCTGGCAATCATAGCTGCCTACGACCTTGCGGTGAATTTCAGCATCAAAGTTAATATGTACAACTT
TGGAGGGCCTCGTGTTGGCAACCCAAGCTTCCGCCAGCACTACGATAGCTGCGTCCCAACAAGCTACCGCGTCGTCATGGACGGCGACATCGTTCCGGGA
TGGCCAAAATTTGTACGTACGGCATCTGCTATTGCGTAGATGTAAAAACTAACGATGCATTCTGCCTATGAATTGTGTACGACTGCAGTGGGGACTTTAT
CAGCATGTGGGGACTGAGATCTCACTCGATGTCGCAGGCAACCTGATCGTCGATCCGAGTTTCGTGGAGCGCCACCTTCATCACTCATCTCGGCGCAAAA
CGACAATGCACGGCACAAACGTCTATCGCGTGTCAATTGCCAAATGTCTCGAAAATCTAACTACGTCGTAAAAGGCTCACAGACCCCTATTGAATATCTA
TTGACGCCACTCTATTCGATACACCTCGAGCTGACTGTGATGGTGTCCTCTTTGCTCGAAGCGTCGCAATCCGTTTCAACATTTTGGAAGAGTTTGCTTC
TTCCTAGAAGACAAGCAGCTAGTGCGCCACCATGGATGGAGACGACCAACAGGCCCAAGAAGGAGTGATCCGCTCGCACGTGGATCTTGCGGAGGCGGCA
GCGAACGGCTCTCGTGCCATGGTATGTGTGCGGCAGAATCTGCAGCTTTCGACATCGGCGCAATCTTCTAACATGATTTTGCTTCACCGCAGGTGGAATT
CCTACTGGACAATGGAGTGCACATTGATACACCTGGAAAAGGTTTGTTCCACACTTGCATGGAGATGTTTCGTTGTACATGGTATATGGAATTGACAACC
TTTTCACCAGATGGAACGACACCACTATGTGCTGCAGCTCTGTGGGGGAACGACATGATGGTCACATGTTTGCTTGACAAAGGAGCCGACGTGTCGGCCA
GGAACGAAGGTAAGCCAGACTTCTTGTTACAGAACAACGTGATTCTCGAGAGAAGGCTAACACACCAACACCTCGACAGGCACGGGGTGGACAGCTCTGC
ATGCAGCCTCATTCCAAGAGCATGGGAAAGTCGTGCGCATCTTGCTGGACAACCAGGCCGATCCTAAAATGGTCGACGCGGAGGGGCGGAGGCCCGGTGG
ACTACGCCAGCATCTCCGAGGCGATTTGGCCCTTCTTCTCAGGTAGGACTGGTCACAATATGCTCCAGACCTCGTCACACTCCTGACTATTGCTCAACTT
GTATAGCTAAAGGTTGCAACAAGAGCCTCAAGTCGGAGTTGATCGCAAAAGGAATCATCCGCAAACTCCCGGACCAGCCTGAGCAGACTCAGCAAAACGA
CATAAAAGCCGACACGGTACGTCTGTAAATGCCTCGCGCACGGCAAAAATCTGTTCCCACCTGCTTTCTCTTCGCTTCTGGCAGATCTCGTCATTCTCAC
GCCCTGGATCCGCTTACACCCGAGCACAAATGTACCCGCCGCTGGCTCGCCGACAGAGCCCTGCAGTCAAGGTGGGCCCCTTCTGTTGTAGTTTTTCTTT
TGCGACTGCAGTTAGCTAACATTTGCTTTCATGTCGAATGGCAGTCACGCGATGGTCGTATCCTCACGGGCCCCATCGATCCGCTCGGTGACATGCCAGC
CGACTCTGACTCGAACCAGCGGCGTCCGTCCCTGAGGAGAATGGGGCTGTAGCTGCTGCACCTCAGAACCAGAACAGCCTTGGCGGACAAGGCAAGGCAC
ACAAATTCTAAAAAGGCAACTTGAAGTTGCCTTTTTCCACCAATAAAAAATAGCTTGCTGCATAAAAAACGAGATATGCCATACGGCAGGTCTTTCATTC
TGTATCACCGGTTTCAGTGTGGTCCACAGTGTCTGCGCTATAGAAAAGTGCCGTTCCGTGGCCGCTCGTTTGGAGCCCCCTCCCTCGGCCGCTCAGTTCT
TGTATCGCTCCGGGCCCAGCACGTCGCTCTACAATGGTGAGTCCTGCACCGCCGGAAGCAGCAACCAATATACAGACATAGCTAACCTTCTTCCCCGTCA
AACGCCGCCCACAGTCGCTTCTTAACAAGGGATCGCGCGTCATGACCCAGTCGCTCCGCGCTGGCGCCCGCAACATGTCGAGCGCCACCGAGCAGGAGGC
CAAGGGTGCGTTGCGTCTTCTTCTCTCGATTGCTATTGGCGGAATTACTGACTTATTGTGTTCATATCGGCAGAGCAAATGCACCGATGGAGCACCATCT
CCAAGGGCATGATCGGTCTCGTGGGCGTCTACACGGTGTACGCCATCGGCGACCATCTGAGCCACGAGCACCACGAGGACCATACGCCCGCCTACCCCTA
CCTCAAGATGCGGACCAAGCCCTTCCCGTGGGCCGAGTCGAACTGCGACCTCCTGGACTCGGAGTGCCGCGCCAAGGCCCGTGAGGCCAAGAAGGCGCTG
GAGTAAGCAGCTGTTAGTGTCGCAAAAAGCATTTAGGGGAGGACCCTCTCCTGTATTTGAACTGACGCCTGCTATTTCGCTGTCTTCGTGTTCGTTCGGA
CCTCAACTCCGCACACAACCAATTGAAGAAAAAAAAAAAAATGAAACGGAGTCTTTGTCGTCTCTTATTAACCAGCCTTGATTCACGAGTCTTCCTTCAA
GGAAGTTCCTTGACAAGCACCTTTGCAGCGTTTTAACGCTTTTAAAAGTAACAACACAAATAACGAAAAACAAACATGGACGACTCGCCAGTAGTGGAGG
TGTCCGCTCTCCAGCGCCTGCCCCAGCCCGGCGAGCCTATCTGCGTGGTAAGTCTCTTGCGTATCCCTTTAGCGCAACTTTCTTACCTAAACTTCCTCGC
CCGCCTGCAGATCTGCGGTCGATACGGCGCCTATGTGTGCGACGCCACGGACGAAGACGTTTGCAGTCTCGAGTGCCGCGACGTCTGCGTGTCCAGGCAA
AAGCAGCAATCGCAGCAACAATTTCAACAATCCGAGCAACTTCGCGCCAAACTGGGCATCAATGTCTGCTGTGGATCGGCAACTGAGACCATCAACAACG
GGGACCTGGAGCCTCGATGGCCGACCCCATTCGTGGACTTTGCGCAAAAACAAGAAGGCGTTCAATTGCCTGAAGAGTTGCTGGTTAACTTGAGTGCCAA
CGGCTTTGATAGACCCACGCCCGTGCAGATGCAGACGATCCCTTGTGTGCTGCAGGGGCATAATGTACGTATTGCGGGGTTGGAGGTTTGTGGCGTTGCT
GATATTTTCTTTTCAGGTGCTGGTGAGTGCGCCAACGGGTACGGGGAAGACGGCGTCGTATTTGATTCCAGCAGTTGCGCAGGTTTTGCGTGCGCGGGAA
GAGCAGGAGGAGATTTTGACGCTAGTTGTGGCTCCTGTGCGAGAACTGGCAATTCAGATTGAGACGGTGGCAAAGCTGCTGGTGAGAGGCATAGCTGACA
TGAAGACGGCGCTATTGGTGGGGGGATTCCCTGTCCCCACCCAGCGCTATCGACTACAAGGTGGAGTTCAGCTTATTGTGGCGACACCGGGGCGCTTCCT
CGATATTTTCATGAACTACAGTGGCGGTGATGCTATCCTGGCAGCTATTCGCATGTGTATTGTTGATGAAGTGGACATTATGCTGGACGCTGGCTTTCGT
CCACAGATTTCTCAAATCGTGGCTTTATTGGTAGCATTAGCTGGGAAAAAGAGCGTCCAGATGCTGTTTTTCAGCGCCACCGTCGCTGGCGAGGTAGAAG
AAATGGTGCGGCAAATCTTGCAAGTTCAAAGCCAGCAAAATTATATTCGCGTCGACGTTCGTCGCAGTGATTCGAAGACAACTGGGACACCGAGTTTCGC
ACTCAACCCTCGTGTTAAACAACAGGTTCGATGGTCGGACGACAAGGTGAAAAAGAGTGAGTTGTTTGAGTTCTTGAAGGGAAATACGAAGAGTCAACGG
TGGGTGAGGTGATTGCATTGACTCTTATGGAATTTCAAGCTAGCTGACATCATTGACGGGTGGCTGATACTTTTTGTGTTGCTGGCGTTGTAGATTGTCT
TTGTCGGATCGAAACTTGGCGCGAGCATGCTGGCTGAAGCCATTGAAAAACGCTGTCAAATTGGTGCAGCAGCGATTCATGCAGATAAAACTCAAAGCGA
AAGACTTCATCTGCTGGAGGCCTTTATTAATCTAGAGACCCCTGTCCTCGTGTCTACAAACGTGCTGAGCCGTGGAATGGATCTGCTGCACGTTCAGAAT
GTTGTGATCTATGATTTTCCCAAGAAAGTGTCAGACTACGTTCACCTCGTTGGGCGTATCGGGCGTGGAGATGATTCGACCGGAAATGTTTTGACGCTTG
TGAATAAGGATGACCAATCAGTTTTTTGGGACCTTGTATCGCTGTTGCGGCAAGCTAAAGTATCGGTGCCTCACGAAGTGTACCAGAGTATTCACACTGA
GAATGCCAAGTTGCGCGCTCGCTCCATCGAAGTCGTGATCGATGAATCTAAACGGGCTTTCCGAATTCGGAAGCAATTGGTTAAGGAAATGGGTACGCAC
GCATCAGAATGGAAGAACTGGGACAGTCAAGAGTAAACGGCGGCGTACAAGGCCATGA