Description :
From Genome Similarity Track
Location :
Scaffold_175:9008- 11038
Transcript NameFunction/comments
Physo_144261hypothetical protein

Sequence
2030 bases(100 bases per row)
AGTTCGACGCCGTGCTATTCCTTACGTAGTATGGCTCGTCCTGGTACTCAGCCGAGCAGTACGGGAACGTGGCGCCGCCTTCGTCCGGGTTGAACAGGTT
CTTGCCAGCGTAGATCATCACGTAGCAGCCCACAACACCGCAGACGGTGGCAATCGTGATGCAAATGGTCTTCTCCCACACCGGGATCTTTCTCCAGAAC
ACCTTCACGTAGAAGATCAGCGGCAGGATCAGGCTGCAGACCGTGATGGCAGTGGCGCCAGTGAAGTCCACCAAGTCGAGGAAGTGGTCCTTCACCAGAA
TCGAGGCCACCGCCAGGATCGCAATCAAGGCGATACGAACCAGGACATATCGAATCACGTTCACACCGCCCTTGTACTCCGACAGGTCTTCCTCGCTCCT
CGTGACCGACACACGCTGCTCGTGGGCGTTGCTCTCGAGGTCGGGGACGGCAGGCGCTGGCGTAGACGCAGCAAGGTACGACATTTTTTCCTCAATCTCG
ACCTCGCGCTCCTCGTTGTCAATGGCGAGGGGTTCCGTCTTGTGCATGCCGAGCACGAGACGCTCCGCCATGAAGAACGCCGGGTGCAGGATCGTCGAGA
AGGCAATCGACAGGTGTAGCTGCATGAAGAGGTACGACATGACCACCGCGCCACGGTTAGCAGTGAAGCCCAGGGTCGTGGTGCTGTACGGGTCCGAGAT
GTTGACGATGGAGAAGAGCAGGTTGCCCGAAAGCTGGCATCCACCGGCGACGTAGCCGATGATGGCGATGGCGAGGAAAAAGGCCGAGGCGAGGCCAAGA
CTGACGATGATGACGCGCGGCATGCGTTCGGGCTGCGAGTGCTGACGCTGGAGGTCGGGGATCACGATGGCAGCAGCGTAGGCCAGCGACAGGTTGCCGA
AGGTGGTGAGAACCTGGTGGAGAGTCACATCGGGCGTGGGCGGCGTGGGGTGGCCGCGCTCCTCGTACAGGAGAATCGCAACGCCAATGACATCAGCGAT
GATCGTGCCAAGGCACCCAGCCACGGCCATACCAGCACTCTCCTTCAGCGTCGGGATGAGCGCCACCGGGATGACGAGCGCAGCCATGAAGATGATCCAA
ACAGTCTGGCTGAACGAGTCGGGGAACAGCACGTCAAGCAGCGTGCCGCCCAGCACGAGGAACGCGCACGGGGCGAGCAGGCACACGCCCATGTGGGAGA
CCACGACGAAGAAACGGCCCCACTTGCCGGCAACCCATTCACCGAGGTCACCGTAAGTCTTCACCGAAGCCGGAGCCACCATCAGCACCTTGGACAGCAG
CACCGTGGCGTAAATGTTGGCGAAGGCCATGAACAGCAGGGCGACGGTGGCGTAGCCCCAGCCGGCGCGTGCGTAGTTGGAGGGCATGCCGAGCGACCCG
ATACCGCAGATGCAGCAGAAGATGTTGAACGCGATCTTGGAGTCCTCGAGCGTGAAGAGGGGGGAGCGCCCCGACGTAGAAGAGGGAGCCGCCATGGTAG
GAGTTGTCGCTTGGGACGGCAAATTGGACAATGAGCTCTGCCGGAGCCGCACCGGCGGGCGTGTCGGTGCTCTGACTGGAGAGCGGGCGCAACAGCCAGC
ATTTTCCCTTTGGTTTGCGCAAAATTGGTTGAAAGACAACGCGCGCCGCGGTCCGTCTACAACCCCTTGAATTCCCCGTCGTTGTATGTCGCACCGGCAA
TGCCGGTCCGGCAAGCATGAATGCAACCGGTCTGCAGGCGCGCGGCCGTCTCTGCGCCGACGTAGACCAGCGAAAGCGATCGCGCAATGCATCAGTGCCC
CGTCCAATTTCCGACACGTACACGTCGTTAAACCGGCGGAGGTGACAGGCAGTCAAGCCGCCGAGCGCAGCAGCACGGCGAACGAGGTGGTGTCCGACGC
TATGGGGCCAGTCGTTCGTTCACATGGCAAAATGGTGGGGCTCCATTACTTCGGAGCCCGTCACATTGGCCCCATCTCGCAGAGCATCCGCATCGTGATG
GGCTTGTCGCCAAAAGCTGTTGCCGAATGG