Description :
From Genome Similarity Track
Location :
Scaffold_162:90067- 92826
Transcript NameFunction/comments
Phyci_71711Hypothetical protein

Sequence
2759 bases(100 bases per row)
CCTACGTTCTACATGAACTCAATTGGTCCGCGCAGTTCTGTTAATCTTGTTCTTAcagaagtatggcgttcacggaggcacaacggcgttccagatttcc
tgaaacttaattgcgcaacaaaccATGCCATCGCTCGGTAAAAATGCGAATTGCCATAGCCGCCGGGTACACGATAAATTCGGGCAGAGGGGTTTCATGC
ccgagtacaatcgtcgttgaccgcaaaacataaaatctaagaagtgaacagacagcgagaaacttggcgagttctgctaggccactgtcgtggcatggcc
ctcgatgcgcATTGGCGCGTGCACCGTACGAGTTGTTCACGTATGCCGATCTGCCCTCGGGGTTATACATGTTGGCTGCCGCTACACGTACCCACAGAGT
AGTTAGAATTTCTGCTCTATTACTCCGCACGAGAGCAGAACAGCATACATGTTGCTTTtgttgtggagcggacatcgttgctagcatacccaggtgtagt
tgatgagtcaatccccgaaaaacactgcagtattatcaccatatttcaaacctcgctgttgtctacgtctgttattcatcgcagtgcactatcgggatct
atccaccgtgaaacccgcttgcaaATTATAGAATAAGGTACCATATTATCAATATGTTAAGCTGGTCATGTTCCACTTTTgtgacggattcatgtaacta
tgcatgattcgtcaatttcttcttacgtaaattgtcaattggtatatctggtgtacacgtcaattgataacttgaccaatgacagttgagaagaagtttt
tgtcaatagtttagcggacgtagctacaacatgctagcgacagttaaaactcaatgtcactcttcaattttccatcgtgagcgcagtaccattacaCACT
GCGAGTTACGGTAAATGTTCGCGTTCCAGCCATTCACCAGTTTTTAGCGTTCAACATCAGCACATGTCATCCCTCTACCCGGTATCCTTACCAACCATCG
ATTCACACTATAGTGCTAGATAGAAAAGAATAAACAAGTTTATCAGCAGAGCTTGGTGATGCATCCTACTTGGCGACATTCTGCTTTCTGGTAATTATCC
GTCATTTTGTGTTGCTTCGAGAAAAACACAGTGGCATGCTGTCCGCAACACACCCACGAAGGCTTGCAGTTAATCCATAATAACAGCATAGTATCGGTGA
TATGCAGCACGAAATACGATGAGATTTTGTCGACAGAGTAATATGTTCAATTAAGTTGAGCGAACAAAAGCTATGCGTGCAGAGACCTGGTGTCTGTGCG
TTCCTATGCACAAATAGAAAAGTGTTAGGACATGTCATATCCGGAGGAACATCAATTAGAGGCCGACACGAAGACCATCGTGGCGATGATTACTTATAAC
GCTACCATTTATTAGCGTTTGGGTGCTTGGAGGCGACAGTATAGGGTCACGTAGATTTGTGAAGTAAACTCGGCAGGGCCAACTAATCGAATCATTCGGG
GTGGCTTCTAGTCAAGAAGGTGCGGTAGTCGGCCTTGGCCTGTTCTGAGACGACATTAAATTTCCCTCCGAACACAACATGTCGTCGATGACGGTAGCCG
GTTTAAGACCCTGCTTGTACCATGTCTCGAATTGCGCCTTCTCCAGCCTCGTTGCGATCGTTGTCGTGGCTAATACCGTCTTGGCAGCCTGAAGCATTTC
CGCTACAGGTTCGGTATTGTACTTCTCCATCAAGATCGTGATCATTACCATTTCAGGCGATTGGTCCTTGTTGCGTACTCCAACGTATTCTTTCCACTCC
CTGAAGTGTCGGTTTGTCAGAACCTTGTCAACTCTGGAATCAAGCTTCAAAAACGTGAATATGTCGTCCGAGGATCGACCGAGGTTCAGCCATTCCTCGA
TTCTCTCGGCGTTGGCGGATTTCGACTTGAACCCAAAACTCTTTCTTCTCCGCTGGTGTCGTCGTCTTGGTCCGCTGAGATCTGGTAAGTTCGCAGGAAT
CTCGCGGCTCGATATAGGCCGTCAGGACGCACATGCTCTTGAGTGGAGGACTCGACTATCATGGGTAGTGTCAGGCCGGTCTTGGCTGAAGCTGGATCGG
CACTTGCGATGAGAATAGCGAACACCGCAAGCACCACGCTCATGGCGCTATCTCGTTTCTTTGCGATTCAGATCAGTGGGCTGAGAGCAAGTTTTGAAGT
GAGCTTGTTGCATCCAGACGGATGAATTTTCACATCACACGAAGCGAGTGGTCTGGCAAGCACCACTTTCTAATTACCAATTGCCTGACTTCATCTCGCT
CTGTTAGTGCTCTGAGATCAACAGTGTTGGTGAGTCGGCAATGGCAGATCATGAGATTCGGCCCTGCACAAAGGAAGGTGGTTAGTTCAGGCACAAACAG
CCACGCGCATATTAGCCGATGTCTTGTGTTATAATGATAGGAAGCTAATTTCTTGCACATGTTCAAAAACAACACTTTTTACGCAGTCGGATGAAGTCTT
GGTATCAACCCAATTGTGATTATTAAACGAAGCGTTAAGATTAGAGGAATTAGCACCACGCGAGCGCCCGCAGAGCACACTATTAATACGAGCGAGTATG
CCTACCGTACTACTACAGTATGTAGTATCCAAACTGTGTGATATCATCATCATCCATGATGGCGAGCTGTACACAAACGTCATCAGTGTTGGTGATACGC
TACAACGAGGCAGTTTGAGATGGGAGAGAGGGTAAATTATCCCTCATCCCCCGTTAAAA