Description :
From Genome Similarity Track
Location :
Scaffold_999:9006- 15718
Transcript NameFunction/comments
Phypl_g11995hypothetical protein
Phypl_g11996hypothetical protein PHYSODRAFT_489802

Sequence
6712 bases(100 bases per row)
aGCATGTCAAGCAAAGTTCTCCAGGGAGACCCGCGCCGCCCCGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCGGACGAGGCCCCCGGCGACT
GGtacgccttcttctcgctcgtgctgggctTCCTCGCCTTCACCATGAAGGTATGTATCATCACCTCTTGTCTGgaatccccccccccccccccNCCCCC
CTCTCAGTGAACGAAGCTAACTAGTCCATCTCTTTTGTGTGTACTTTGCAgtggaaggagctggccTGGGGCtccctgctgctgtgcgtggGCTCCTTCA
CCAACATGAAGTCGCAGGACATGAACACGACGCAGGTGGCcatgtccttcttcttctccagctcggcccTCGTGTCCGCCTACATGGGCGCCATGCGTCC
GGGCATGCCCATGCCCCCGTCGGCTGAAGCCCCCGCTTCATAGAGAGGGTGAAACCTATAGGGAGAGTATAcccagcagacgcagaggTGATGGAAGGAG
GCACCTACCTGGTATCTGGCTGCTGTAAGAATGGAAGAGCCGAGACTGTTGGTACTGTGCTTGGGTCTGTTGCTCTTTGTTGTGACTAGTATCTGGACAT
CGGAGTAGTAGAAGTATTGGAAGTACTGGAGGTTACGACGTGCTATTTAGGACGGACGCTGACTGCAACAGTTCGCGCTGGACTATGACAATTGGGCCCC
GTGAAGCGTACCCTGAGAGTTTTGGagaggaagcagcacgcgcgaAGGAGGTGTCTCGCGAGGATGGAGATGGTTACCAGAATGCCAACCATGGGGCTGG
CGGCGTGCTGTCTCACAAGCTGATGAAGCGGCCTCGAGGCCCTCCGCCAGCCAAGATGCATGCGGTGTCGACTGCACCGGCGATCCGGGTCTTGCCACCT
ATTAGGCCAGCAAGTCCTAACACGCCTGCTGCGTCCTCGACCATGACTCTGGAAGAGAAGCAACAACGGCAGATGCACTCGTTCCTGCGCAACTTTCTCG
CTGCAGGTGAAAGCGGACGCTTCCAGCAGGTGATTGACCTCCACCAGCATGGAATTGACACGGGAATCACCGTCAcggacgcgacgctgcaAGAAGTGGT
GCTCGCGGTACCAAAGCTGCGTGGATTAAACCTCTCCGGCTGCTCGCACATCACGGATGCCGGACTTTGGGCCGTCGCGAGACACTGTCAGGCACAGCTG
GACACCATCTATCTAGCACAATGCGAAAAAGTGACAGAGCTTGGCCTGCGTCTGCTCGCTCACAATTGCAGGCTTGTGCTAGTAGATCTCAGCGACTGCC
CCCAGCTCAATGATGCCGCGTTGCAAACActggctgctggctgctggatGATCGAGACCTTCATCATGAAGCGGTGTCGAGGAGTCTCCGATGCGGGCAT
CGTGAAAATCGCCCAGTGCTGCAAAGATTTACGCCATCTGGATGTTTCTGAGTGCTCTCGGCTCGGTGAGTACGGAGACAAAGCGCTACTTGAAATTGGG
AAATGCTGCCCGAAGTTACGGGTGCTGGACCTCTTTGGTTGTCAGCACGTGCACGATCCTGGTGTCCGCGCCGTCTCGAAAGGCTGCCCACTATTGACCA
CGCTCAGGCTTACCGGATGCCGAGACGTTAGCAGTGTCGCTATTCGTGCATTGGCGCAACAGTGCACACAGCTTGAGGTCTTGTCCCTTTCTGGATGCAT
CAAGACCACAAACAGTGATCTCGAACTGCTAGCTACCAATTGTCCGCAGCTAACGTGGCTTGATATCAGTGGCAGCCCCAATATTGACGCTCGCGGTGTG
CGTGCACTAGCCCAGAACTGCACTTCCCTCACGTATTTGAGTTTGGCAGGATGCCAGCGCGTGGGAGATGCTACGCTGAGCGAGCTTACCAGCGCAGGAA
CGGGAGGACTCGCGAAGTCTCTTGGAGAGTTATCGCTGGCAGATTGTCCTCGCGTCACGGAAAATGGGGTCGACGCGCTAACTACCGTCTGCACAAACCT
TATCACGCTCAACCTCACCAATTGCAAGTTGATTGGGCGAAGGTTCCTCCAGAGGCTCATTGGGAAGCTCGAGTTTGTACAATGGGCCACGAATTTCTTT
GGGTACGAGCCATTACCAAATGCCGCTGAGCTTTGCCGCCACCGCGATCTTCTCTTGCTACAATTACGAAGTGCAATCAAAATCCAATCAGCGATGCAAG
GGTGCCTAGCTCGTGGGGGGCTATGGCAGGCAAAGCTCAAGTTTGTGGAGCGAAAGATATTGCCTAAGATCCAAGCGCGCGTGCGTGGATTCCTGGCTCG
AAAGCGCATTGCAATAGAGAAGCAGTATCAGGCAGAAGATCAGGCTGCACGATTAATTGGGCGCGCCTATCGTGACTTGCAGCTTCGCCGAATGTTGGTA
CGCGCCAAGAGGATTCGTCGAATTAAGGAGCACgaaggtgaagcagctctCATTTTCCAGAAGATATTCCGCGGCTATCGCGATCGCAAACTTGTAGCGA
AGATGCGATACGACATGTATtgcgagcagcagttccaaGCTCGAATAATGGCCATGGAGAATTTAGCAGCCACAAAATTGCAACGGGCTTACCGAGGGCA
CCGCGGGCGGTCCGATGCTGCTATGCTGCGCTCAATCAATGAGGCCAAACGTCTTCAGCACGAGCGAGAGGTTCGGTCAGCAGCGTATATCCAGCGCGTG
TATCGAGGTCACAAAGGACGCAAGGTCCGTGCTCAACGACTTGCAGAGTTGTTTCACCAGCAACAATGTCATCAGGGTGCCATCCAGATGCAAAAAGTGT
TCCGTGGTCACCGAGCGCGACGGCATGCTGTGCTTCTACGAGTAGAGGTCAACGAACTGCGGGTACTCAATGTTGCTCTAACAATTCAAAGATACTGGCG
AGGCATTCGCGACAAGCATTTGGCCGCTGTGTTGATCGGGTTAATCAAGCTGCGTGCCCGTGAAAAGGAGGCCGCACACTCGATCCAGGCTGCGTATCGT
ATGCACGCCTCCAGAGGCTTCATGAAGGCGATGAAGCTGGCTTTGGCAGCACAGTTAAGACGAGTGAAAGCAGCCACAGATATCCAACGTCTCATTCGAG
GTCACCGTGGACGGGGAGAGGCAGAGCTTCGAAGGGAGTTGCAGCGGTTCCGTCACCAAGCCAAGCCTTTGTTTGCAAAAGATGCACGTTTACAGGCCCT
TGTGGATGGCTTGAACGATAAAGTGGAACAGCTACAACACAAAATTACTGCCGATGAATCAGAAGAGCGTGCGTtgacgctcgagctcgagaaaACCCTT
CAGATTAAAACGAAGTATCACGACTCGAGCCGTATCACCGGAACGCCTCAGCGCTATCTGACGCAGTATCTCCAAGTACAGCTTGCTGACCAACTACGAG
CAAAACGAACCGAAATTGCGCTTGATGGGCGGGCATTTGAAGACCTGACGACAAATCTGAACGACGCTCAGAAGCAGTTAAGAGGTGTTAGACGGGAGCT
CGAACCGCTAACCGAAGGTGTCATCAAGAAGACTCGTGAAAACCGAGTGAAGCGATTGCAGGACAAGGTGcgacacgagcgccgcgcggcAGTCATTATT
CAGAAGATGTTCCGTGGCTTCCGTACCAGGGCAGCAGTACGAGAGGGGGGAAATTGCTGGATTCGAATGGTTTCTCCCGACAATGGTCGACCGTATTTCT
ACAATGGATTGACGGGAGCCACACGATGGCACAGACCGCTGGCAATGGACATTTTCGGAGATCAATTTGCGGAGCCCATGATGGAGTCTAGTGAAAAACC
CGCACCAGAAGCACCGAACAGTATACAACAGCCTCCAAGCAGCTACCGCAGCATTTCTGATCGGCAAAATACTCATGACGACAGACACCAACCTGCTCCA
TGCAACTGGTACGAAGCTTTTGATGACAAGGTTCAAGCCCCGTACTATTTCAACAGCCAAACCAAAGAGTACCAGTGGGATAAACCCGACGCCATCGATA
ATGCGTACTTCACTGACAGTCAAACGTCTCGAAAGCGTCTAGAATggctggaagagcagcttcaagacCCTGAAGGTTTGATCACAACTGCACAAGTCCA
GTTGCCTGTCCTAGGCCAGTGGGAAAGGCGTGTCGACCCACTCACCGAGTACGTTTTCTTCTATCATCCACCAACCGGAGTGATTAAAGCGTCGCTGTCA
CCACGAAGTGTCCATGCCTCACTAGGTGACACAACCATGAACTCGCGCCGTTCTGCTCGTAGCATCGGGACCTCTCGATCGCTTCATTGGCAATATCGGT
ATGGCTACGAATACGATGCTAATAGGGAACTTgtcacgagctcgaggtctCAGCCGCGACCTATTTGGACTGAGCACACCGATCCAGGCAACGGCATGAC
GTACTACTACAACGCGTTGACCAATGAATACCGATGGGAAAAACCTGAAGACTTCGACATCAACTACGAAGCGTTCGCCAGCGGACGCGGTGCGAGTACC
TCCGCTCGAAAATGGTTCGAGATGGCTCATCAAAAGGCAAATGgcgaaggcagcagcgctctcACAACTCGCTCGTCAAAATCGCGCACCCTTGGCAAGA
AGTGGGTCGAACTGATCGACCCAGAGACGCAAAACACGTATTACTACAACGAAGTGACAGGGGAATCACGGTGGTCCCTCTCACCTCGCAGTGCTCGGGA
CACGTCCGACACCGAAGATCAAATCTCTTTAGCTCTGTTCGCACaggtgaagcagcttcgtgatTCCCCCGTGCCGTATTCGTCTCGGGACCAGCATATG
AGCTGGCTGGAAGCAGCTATCGCCGAGAAGGACTGGAAAAAGTCGGATGCGATCGTCCAGCAGATTTTCATCCGTGAGCAGAGCCAAGTGGTGACTGAGC
GGAAGGCtcgagaggaagaggagaacGTTTCTGCAACGATAAGCGGACCGGTGGAGGGCGATAGCTCTGCCCAGGCGACCTCTGATCCAACTCCAAGCGC
TTGGATCGAGTGCCGAGATGAAAGCAGCGGTGCCACTTACTACTACAACCAGGTGACAGGGGAgacaagctggagcaagTCAGCAACAACGTCTAGCTCA
GCCTACGTCGAACCAGGGCCACCTTTAGCACGAGCAAGTCAATGGCAGGAGATGCAAGACAGCAACGGTCGGACGTACTACTACGACCTGATGACTGGAG
AGGCAGCATGGTCAAATCCAACGTGACACCGACAACTTGCAGAATACACTCGCATCTCAGGAACTATAACTTTATTCAGCAGCATATCCGCGTCAAAACT
ACTCACAAACCCTAGTAAGCATGGGAATGGCAACTTACTCCAGTCCACCAACGCAAACCATCTTCGTCTCCTGGTACTCCTCCAGGCCCATGAACGAGCC
CTCACGTCCCAGACCAGACTGCTTCACTCCGCCAAACGGAGCCTGCACGTTCGAGATCACGCCCGTGTTCACACCGATCATACCGCAGTCcagagcacca
gcaacacgcCACGTGCGAGACAGGTTCTGCGAGAAGAAGTATCCGGCAAGACCAGCCTCCGTTCCGTTGGCCTTCTCAAtcacctcctcctctctAGAGA
ACTTGAACAGCGGGACGACGGGCCCGAAGATCTCCTCGCTCCAGACGCGCATCGTGTCGTCGACGTGGGCCAGCACGGTGGCCTCGTAGAAGTTGCGTCC
GatgtcgctgcgcttgccACCCACCAGAGCCGTCGCGCCGTTCGTGACAGCAtcttccacgagctccgacgTCTTCAGGAAGGCGTTGGGGCCAATCAAC
GGGCCGAGGCTCACGCCTTCCTCGCGCGGCGGGCccatcttgagcttcttgacgcgctccacgagcttggccgCGAACTCGTCGTAGATGCTTGCGTGGA
TGAAGATGCGGTTACTGCACACGCACGTCTGGCCAGTGTTGCGGAACTTGGAGGCCATCAGGCCATCCAGAGCCTTGTCGAggtcggcgtcttcgaaCAC
AATGAACGGCGCGTTTccgccaagctcgagcgACACGCGCTtcaccgtctccgccgaCTGCTCCATCAGTAGCTTCCCGACACGGGTGGAGCCCGTGAAC
GAGATTTTGCGCacgtcgtggctgctggtgAGCGCTCCCCCCACTTCGGCCGCCTTGTCATTAGGAGACGGCACCACGTTGATGACCCCGGCAGGGATGC
CGacgtcctcggccagcttggccagcgccaaggcggacagcggcgtctcggccgcAGGCTTCACCACCGCCGTGCACCCAGCCGCCAGACACGGTCCCAG
CTTCCTGGTGATCATGGCCAGCGGAAAATTCCAGGGTGATATGATGCCGCAGACGCCCACGGGCTCCTTGATGGCCATGATCTTGTGGTCGGGCGCGGAC
GCGGAGGGCAGGAAGCCGCTCGAGTGCATGATCTCGTGCGCGTagaagtcgatgaagccgGCGGCGTAGGCCACCTCGCCCTCGGCCTCGGGCAGCGGCT
TGCCGCTCTCCACGGAGGCGATGACGGCCAGGTCCTCGGTGTTGGCCACGATGGCCGCGTGCcacttcttgagcagcacggagcGGGCGGCGGGCGTGGT
CTTGCGCCACTTCTTCTgggccgccagcgccgccgcgatggCCTCGTTCGTCTCGACGCGGCCCATGTTGGCGACGCGCGCGACCTCCTTGTCGGTGGAG
GGGTCGGCGACG