Description :
From Genome Similarity Track
Location :
Scaffold_156:90047- 92299
Sequence
2252 bases(100 bases per row)
AGGGCGCGTTGTTGCCTTCACCGTCTTCGTCACGATGCTGCCGTCAGCTTCCTGAGACTCGAATACCTCCGTCTGCACTGACTCGCCTGGAGCTGCGCCG
GCCTCCACGGTCGAGCGGATCACACGAGCACCTGGCATGGACGTCGCGGTACGGCCAATTATCGTCGTCAGACTGCCTTCCTCCACGTCTGTCTCCTCGC
GCGTCTCCGTCTCCACCGTAACGCTCTTCTCACCCGTAGTCGTCTCCGTCTCCGGGGTTGTTTCCACGTCAACCGTCTTCACTACCTCGCGCTGGCCAAC
GTCGAAGGGGATCGTCGTCTGCACCGTCTTCGTCACGATGCTGCGCACCAAAACGTCAGCTTCTGAGACTCGATACTCGTCTGCACTGACTCGCCTGGAG
CTGCGCGCCTCCACGTCGAGCGATCACACGAGCACCTGCATGACGTCGCGGTACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCTCAGC
ATCCGTACTAGCCTTCGCACTCGTGTGCACGGAGGCGTCGAAGTCGGCCACCTCGCCGCGCATAGCGGTAAGGATTACCTTCTTCAGGTCACCGCTCAGT
TCACCGCTCAACACCGTTACTAGGTCGTTGCCGTACTTCTCCTGGAACGTTTTCTTCAGTAGCGCAATCTCAGCATTCGTGCGAGCCATCACGACCGGAT
AAATCCATTTCTCCGTCGTGCCTAGGCCCACCGTCGCCTTGCGCAAGATCTCGGCTTCTACGTGCTCCAGGGGACTCGCGAGCATCTTCAGCAGAACGCC
ATAGTCGCTCGTGCTCTTCACCCACGTCGTCAAGCTCTGTTTGTACAGAATGCGGTAGCGCCACCAGATCAGATAGCGCTGCTCCACAGTCTTCGACAGC
AGCAGAGATGCCAGGGAAGTCTCAGCCGAAGTCGTGCTAGAGCACACGCGGTGGATCTCCTGCACGGCCGCATCGATCTCGGCAGGGAACGTCATCGACT
CAATGCTGCTGCTCTCACGTGCATAGCGCACGTACAGACTGCTCATTGATATCGAACCAGCGACTGCTAGCTCTGCTGTGCCCTTCTCGTCGCTCATCGT
AGACACCGCTGTCTTTGAAGCGGCAATTGTACTTTTCGGTGAAGCTGTTTTCATAGAATATAATCTCTGTGAAGCGTGTGGCTTCGCAATGTCGTTGTCA
TTCATGCTGGAACCTTTGACATGTTTGATTACATCGGTTCCATTCAAGAGTACAGCGTCATCCGGAAAACTCACTACAGCGGACATAGGTTGGGTGCGCC
GATTTGCCCAGTCTTCGTTCGCTCGATCGATGACTGTGACATTAAACTGGGC