Description :
From Genome Similarity Track
Location :
Scaffold_1259:9004- 11501
Sequence
2497 bases(100 bases per row)
GATTCGTTGGAGAACATCAACGGTCGTACGAATTAGATAGTCATAACGCATCAATCCGCATACTTCACATATAACCTCACACAAAGAAGTAGTTGGAAGC
TGCTCGCCCAACCTCGGATTCATTCTTCATTTTGCTTCCTGCCGCGCAGATGGAGCCTCTTTCAACAAAGCCGCCCACGAAGTCCGATGGACAGAGTGAC
GGACCGAAGCACAAAACGAAAACGACCAGAGGCATTCCCAAGGGATCCGACAAATCGGCTCAAGTCGTCACGAAACCCCAAACTGCTAAGACTTGCGCGT
CTCACACAAGATTACTGTTCCAAAGAATGACAAACCCAAACGACCTAAGTCTACAACTACCGGTGAATTAGCCAAGCTTGGGACTGCATCCAaacctcca
gctcctgcgctCACTCAAGAATCGTGTCTACCCCTGCCCCTCCAAGGTGACGTTGCGAATGATCAGCTCGCTCTTCAAAATATTCGTAAAGTTTCTATGG
ATATACCGCGAATTGACGATATAAGCTCCAGTCCGTCCCCCCTAAAGCGACGTGCATCTGAGCGCGAAGCTGCTACTGCGGTTGTTACTAGCAACGTTGC
AAATACTGATGCTTATACCGGTGCCCACGTTAACCCTGGACAAGCTCTTCCCGACGACCGAGGGCACGCCTCGGCTACTTCTACTGAAAGCTCGGTAACG
TTGAATCCTGCTCAAACACCGGAACTATCACCGATACGTGCTACACCGCTACATCCTTCAGATGCTACACCCGAGCTCGGACATAGTGCTGCACACTCGC
AACTACCCGTATACGATGTTAAAGTTTTGAATCCAGAACTAAAAACGCCGTGGTGTTTTGTCAGACGCATTCTAGCTCGCAATCCCGTTCGAACGTACAA
ATCGTGGCGTGGAAAAGGCAACTTGTTCGAAACCTTCGCGACAGACCAAAGCGGTACAGTTGTACGCGTCACAGTTTTTAACGACGGCGTCGCCAGATTT
TTCGATACACTCATTCCTGGGACAATCTACTCTTTCTCCACTGGCCGAGTCAAATCTGCAAACTCTGCGTTCGCTCCTCGCGATTCTACTATCGAGCTTT
CATTCGGAGGGGACGCTGATATTCACGAAGTGGAGTCCACTACGGACTTCCCGGGGCCCAGTTTTCAGTACACCAAACTTGCTGATCTACCGAATGCAGA
ACCTTCCACTTATCTGACCGTCTCTGGCGTGATAGTCGAAACCGGTCCTCTCAAAAATATCACTACTCGCTCGGGCAGACAGACACCCAAGCGCGAATTC
CTGCTAGCAGATGATTCCGATACGGAAATCCTGTGCACCGTGTGGGGGCAGGTCGCTGAGGAAATCCAAGAATTTCACGAAGGACGTACCATTCTGATCA
AAGACGGCCACATTTCGGACTACATAGTTGTGCGCTCTATTAACGTGGGAGTAGGATTTATCATCCTTCAAGAGCCCGCCACTTCTCGGACCGCAGAACT
ACTACGCTGGTTCGCTAACGTCCCCCCTGGACACAGCTTCGTCTCCCTCCATGGATAGCTTAACCAACGCCTCTCTGTTCATCTCCGATTTCTCGTTTTC
ACCAACTTCGTGCCACGTTCGCAACCCACTTCCATTAACCTAAACATTTTCTTTTACTCCAAGCACGAATCAAATTAATTTCAATACCAAAAAGCACTAC
CAGCCCTATTCTCTAGTCCTGGCCCGTAGCTCGAGCCCAAGTTGAGCCTCTACCCGGGTGCTCTATGTAGCTCGTGAGACGTGAGCTGCAAACCCATGCA
TGCACAAGTACTCATGAAACACTTCCTTGCATTAGTAGTGGCTAAAATGCAGCCTAAAAGCTATCTTACGAACGCTCGCATCTGTTCGTGAAATAGCTTG
TTTttgcatgtattaatagctgTTCGAGTTTCATCACCAGCTATGTGCCCTGATGCCCACTGTATAATAAGTCAAAGTTGAAGACACGAACTTCAACCAA
ATTAAATGCGGCGCTTTGTTACGCCAGacatgttgctgcaggaattGGGCTCCACCAAGCAGAGTCGCTTTCTACGTCTAAGCTGcgctgcttgcttgct
tgtcgtgctggaggcgccGACAACAGACCTAACAATAAGCTATCGACTCGGATGGATGGAAGCTGTACATGGCGACGTGAGCAGCTACATGCAACAGCTA
TACGTACGTACAGCTTGCTTGCTAGTAGCAAGTTGCTACCCTCCCCCGTCTTGACTTGTCTCAAAGAGGCCCTCCTATTATCTGACAAATTGGACGATGT
TCGGTCTCCTCTTGCTTGCTCGCACTTTCGCCAGACGTCCGGCTACGACGCAGTATACAAGTTTACACAGCGAAGGCTACGAAAAATACCCTTGGTACAC
TGCCGAGTCTGCAATGCTTAGCGACTTCAGCATGGTGAGCTACCCAATGCAGAATGGCTTTCGTTTCGCCATCGAGTTCAAACCCCATCAAGGCTGC