Description :
From Genome Similarity Track
Location :
Scaffold_505:9001- 10240
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_505-abinit-gene-0.23Conserved gene of unknown function

Sequence
1239 bases(100 bases per row)
CGCAGACGCCTGACAATGGGCACGCGCCTACCAATTCTGGCTCGCTCGGGTTCCGGGTCGCAGCGACCGACGAACTGGACAACGAGTTCACTCTGTTTGT
GTCGCGGCAAAAGGCGGAATACCTTTTCAGCACGCTACCTCACAGTCGAAATGTCTCGACGGACGAACCGGCGCTCGAGCCGATGGCGAACACTATTCTC
GAGTACTTGGACATCATCGGCAATCGTAATCGAGACATTGGAAAGCTGACTCTGCGCGAGCCTGAAGTCCAAGTGAGCAAGCGGAAGCGCGTCATGCCGG
TCAGGGCATCATCGGCGAAGCAACGCAACCCGCACCTGCCTTCCAAGCTGCAAGACCAGCGAGCAACGCGAACCAAAAAGACTGTGATTCGGACAATGGA
AGCGATTGCGCTAGCTCACCAAGCCAGCGACAGCTTGATCGTCACCAAGGACCACGTCCCTGAGGAGTTAAGTCCGCGAACCCGCCGAGCGCGCAAGAGC
AGTGACGATAGCCTCTTACATCGGATGGCGTATTCATCCCAGAAACCCGTGTGGAAAACAGAGTTGGAGCCGAACTATGAAGACACGGGAGGATTTGAGT
CGATTATGAGTCCGCGCGGTAGTGCATTCGGTTCGAACAACACAGCCAAGAACTTAAGTCCGCTCAAGCACGAGAGCGGACTATCGCCGACCCGAAGAAC
AGTTCCCGAGCGCAAGCACAAGCACAAAGATCTCTACGAGCGGCGAGAACGAGAACGAAAGCAGCGATTTCTTATCGCCCGTGCGAGGTCGTCCTCTGTT
CTGATGGGACTCTCGCCAGAGCTCAACGCAGCAGATTTGGCGTCCGACCTTGAGGAAGAGCTGCAAGACGAAGATAGCGCCGATCAGCCGATACAAGACC
TACTGCACAGGCAGGCCGTCCGATCTCGCTTCAATGCTGCCGTACGGAATGCATACGCCGTTCGGACGTTCCTGGGGGTAAAATCGCCTCCTGAGAAGGA
ACAATTTCTCCGCCGAATAGTGCGCGACCCAAGTCAACGTCCAGTAGTGAGAAACTCCGTGGGGTCAGTCGATTTTCCCGGCGTCGGCATCGAAATCACT
AGTGAACCGCCAGAAACCCGCAGAATGTCAGTCAAAGACGATCCGTTGCTGAAAGAGAAGCTGCGTCTATACCATGAAGCCTCGCAACGCAGTTTCCTTG
CAAGAGACAAGGATAGAAGTCTCTCTCGACGGTCGAACA