Description :
From Genome Similarity Track
Location :
Scaffold_27:90002- 91277
Transcript NameFunction/comments
Physo_412831cutinase, putative

Sequence
1275 bases(100 bases per row)
CGTCTCGGGTTCTCTAGGCTTGACTCTGACTACGGCCTTTACGAACGAAAAGTGGGAGAAAGTGGTGAAATCTCTATGCTGTTGACGGAGTACGTTGATG
ATGTCCTACTGCTTGGACCACCTGATCTGTGCCGCGGCGTCCATTTCTTCATCCCCAAAACGCACCCCAAAACCCCAAAAATCCCCAAACGTCAAACCTC
ATATTTAAGAACCATGAACCTAACTTTTTACTAAAACCCATTATATATCTAGCTTAGCGTAACCAGCCGCGCTGCGCTTGGCTGGGCGCCCCTTCGACGC
CCCCGCTGTTCGCTTCGCTCGCGATAAAAAGATTCTCTCACCTGGCGAGTGCAGTGTTCGGCTCGCTGGAATGCTCGTCGCTGGGCCCGCCTCCGCAAAT
ACCGCGCGACCCTGCTTCGCTGGCACCCCGCGCGGGTTTGCTGCGGCTACGCTCCTCGCAACCGCTCACCTCCGTTGGTCGGGCGCTATCGCGCCTCTGG
AATATTACACAAAAAATTAGCCTAATATTTAGTTACCCCAATACTAAGACTTATTTATTTTGGGGGGGACAGTTTGGGGGGCGTTTAATTGAGATTTCGG
GGAGTACCAAACAGTTTTTATTGAAAGTCCCCAAAACGTTTTGGGGGATTTTAGGGGACGTTGAGTACGTTTTGGGGATGAAGAAAATTCTCCCTGTGCC
GCAGCGTCGCACAGCAGCTTACCAAGGAGTTTGAGCTGACAGAATTGGGCCCCGTCAAGTATCTACTCGGTGTAGAGATCCAAATTGACCCGCTACGTAA
GGAAGTAGTGTACGGTTCAACATGGCGTCGTGCAAAGGCTGCGCGACACCAGAAGCAACAACACCGCAGCAGTTACGAGCTCCTGTTGATAAATCGTACC
TCCCGTACCGTGAGCTAGTGGGAGCGCTCCAGTACCTGGTTTCGGCGTCAAGGCCGGGCATTGCCCACGCGGTGCGGAACCTGGGCAAGTATCTGAGCAA
CTACACGTACGAGCACTACTTCATGGCGAAGCGAGTGCTGCGGTACTTAGCCAACACCGTCGACTACGGGCTAGTCAACACAATTGGAGCCGGATCAAGG
GTTACTGTGACCTGCTTTACGGATGCTGACTACGCGAACGATGTTGACGACAGCAAGAGTATCAGCAGATATGTGACTATGCTAGATGGCAATGTGGTTT
CGTACGCGTCTCGAAAACAAGAAATCAATGCCCAAAGTACTACCGAAGCGGAGTACGTGGCGATGAACGAGGGCA