Description :
From Genome Similarity Track
Location :
Scaffold_2052:900- 2068
Sequence
1168 bases(100 bases per row)
CGCGAAGGAAGTGAGTTGCTCTCTCAGCTGCGCGACCAGTTGGTTATGCTTCCTGAGATGTATGACTTGACCCCTGAGTCCAAGATCGAGGAGGCAGGTG
TTGGAGTCCCTGGGAAAACGACGCCCGAGATGGAAGACCAAGTGAGGCGAATTCTGGAGTATCATCGGAAGATCTTCTTGGGAGACGGCAATGGGGCTCC
CCCACCTGCACGTGGAGTGGTTTGTGACCTGGATGTAGGCGAAGCTAAACCTGTTGCGCAGCGTCCAAGGTCCATTGTGCCACACCTGTGGACCAAGGTG
AGAACTTCTGAAGAAGCTTCTGGAGAACGGGCTGATCGACGTCCCCCTGGGCATCTCCAATTGTGATCGTCCTCAAGAAGAATGGCGTTGACATCCGGAT
GTGCATCGACTATCGCGTGGTGAATGGCTTCATCAAGCTCTCGTACTATCCGCTGCCGCTCATTGACGATCTTTTGATTGGCTTTGAGTCGGCGATGTGG
TTTATGAGCTTGGATATGGCGAGTGGTTTCTGGGCTATCAAGATGACCGAGAGAGCCAAGTTGATCTCTGCGTTCGTCTGTCCCTATGGGCACTACCAGT
GGGTCAGGACGCGCCGTTGATCTACCAGGCAGTTCTCAATAACTGTATGTGGGGATTTCTGCGGCTTTCCCCTGAGGAAGAAGCTGAGGTCGACCAGGAC
GTCTTGGACTTTTTGGGGTTGAACTCTGGGGAACCCAGAGTTTCAGGTGAAAATGCACCGCGACTTTCAGTGTTGAAGGACGAGATGACTGTTTTTCAGC
GTAACATCCCGGCTCCCTCTCTGATGGGCCCTGTCCTGGGTCGAAGCTCGTATATTGACGACATCGCCCATGGTGCGCCTACTTGGGAGCGGATGTGCCA
GGATCTGAACGCGCTGCTCTTCCGACTACGTTACTGGAATATCTCTGTGAGTCTTCCCAAGAGTGAATTCGGGAAGTTGTCCATTCCGTACCTCTCCCAT
AAGATTATTGCTGAGGGTATCCGGGCGACCCCTAAAGTCGCGAAGGGGGTCCAAGACTTGCCGTTCCCGACGACACTGAAAGACGTCCAGAGTTTCATGG
GGAGTCTGAATTACTACATCAAGTTCATTGAAGATCTACCCATGATCGCGGCCGTCCTGTACGAGCTG